[Omaha.pm] BioPerl on FLOSS Weekly
Jay Hannah
jay at jays.net
Mon Nov 2 14:57:46 PST 2009
On Nov 2, 2009, at 2:06 PM, Todd Christopher Hamilton wrote:
> Ah well. Jay pointed me to some stuff he is doing but I am not
> smart enough to understand so I've go that going for me.
If I can do BioPerl, anybody can. There's just a lot of biology /
chemistry buzzwordiness thrown around. After that it's just a bunch of
scalars, arrays, and hashes. :)
j
>CR936259 Natronomonas pharaonis DSM 2160 plasmid PL23 complete genome.
GCGTGACTGAAGACTTAGAGTTTGCGGTCGAGACGGACTGAAAACCCAGAACGGGATTGA
AACATTACGGCGAATGGACGCTCGATATGACGTTTGACGATGTCGAGACGGACTGAAAAC
CCAGAACGGGATTGAAACGTTGCGGTCGACGATTCAGGCGACCAACTCGAACGTCGA...
More information about the Omaha-pm
mailing list