From enobacon at gmail.com  Wed Feb  3 16:27:20 2010
From: enobacon at gmail.com (Seven till Seven)
Date: Wed, 3 Feb 2010 16:27:20 -0800
Subject: [Pdx-pm] Introduction to Parrot -- February meeting next Wed.
Message-ID: <201002031627.20762.enobacon@gmail.com>

see http://pdx.pm.org/kwiki/

Wed. February 10th, 6:53pm at FreeGeek -- 1731 SE 10th Ave.

Introduction to Parrot Virtual Machine
speaker: Jonathan Leto

Come learn the basic things you need to know about Parrot Virtual 
Machine to start hacking on

 1) Parrot VM itself 
 2) Languages built on top of Parrot, High Level Languages (HLLs) 
 3) Projects and Libraries that use Parrot 

A short, down-to-earth introduction to the current state of Parrot will 
be followed by examples on how to hack on Parrot projects or how to 
start your own.


As always, the meeting will be followed by social hour at the LuckyLab. 
-- 

        http://pdx.pm.org

From gorthx at gmail.com  Fri Feb  5 07:21:06 2010
From: gorthx at gmail.com (gabrielle)
Date: Fri, 5 Feb 2010 07:21:06 -0800
Subject: [Pdx-pm] Introduction to Parrot -- February meeting next Wed.
In-Reply-To: <201002031627.20762.enobacon@gmail.com>
References: <201002031627.20762.enobacon@gmail.com>
Message-ID: <48bb92b1002050721v18eee88cs3c34ba1dff775ba9@mail.gmail.com>

On Wed, Feb 3, 2010 at 4:27 PM, Seven till Seven <enobacon at gmail.com> wrote:

> A short, down-to-earth introduction to the current state of Parrot will
> be followed by examples on how to hack on Parrot projects or how to
> start your own.

Is there prep work we should do, if we in the studio audience want to
follow along?

gabrielle

From jaleto at gmail.com  Mon Feb  8 13:04:10 2010
From: jaleto at gmail.com (Jonathan Leto)
Date: Mon, 8 Feb 2010 13:04:10 -0800
Subject: [Pdx-pm] Introduction to Parrot -- February meeting next Wed.
In-Reply-To: <48bb92b1002050721v18eee88cs3c34ba1dff775ba9@mail.gmail.com>
References: <201002031627.20762.enobacon@gmail.com>
	<48bb92b1002050721v18eee88cs3c34ba1dff775ba9@mail.gmail.com>
Message-ID: <9aaadf9c1002081304n5c823f0ck340b5d9db1c7955f@mail.gmail.com>

Howdy,

Good question! Parrot 2.0.0 just came out, so installing that on your
laptop when you come by would be useful. You can check if your package
management system has it, but you can also download it directly from
[0]. You can also checkout the latest svn with:

  svn co https://svn.parrot.org/parrot/trunk parrot

or if you prefer git (you should), use my github mirror with

git clone git at github.com:leto/parrot.git

Reading "The Parrot Primer" [1]  would also be a good idea.

Duke


[0] - ftp://ftp.parrot.org/pub/parrot/releases/stable/2.0.0/parrot-2.0.0.tar.gz
[1] - http://docs.parrot.org/parrot/latest/html/docs/intro.pod.html



On Fri, Feb 5, 2010 at 7:21 AM, gabrielle <gorthx at gmail.com> wrote:
> On Wed, Feb 3, 2010 at 4:27 PM, Seven till Seven <enobacon at gmail.com> wrote:
>
>> A short, down-to-earth introduction to the current state of Parrot will
>> be followed by examples on how to hack on Parrot projects or how to
>> start your own.
>
> Is there prep work we should do, if we in the studio audience want to
> follow along?
>
> gabrielle
> _______________________________________________
> Pdx-pm-list mailing list
> Pdx-pm-list at pm.org
> http://mail.pm.org/mailman/listinfo/pdx-pm-list
>



-- 
Jonathan "Duke" Leto
jonathan at leto.net
http://leto.net

From merlyn at stonehenge.com  Mon Feb  8 13:11:21 2010
From: merlyn at stonehenge.com (Randal L. Schwartz)
Date: Mon, 08 Feb 2010 13:11:21 -0800
Subject: [Pdx-pm] Introduction to Parrot -- February meeting next Wed.
In-Reply-To: <9aaadf9c1002081304n5c823f0ck340b5d9db1c7955f@mail.gmail.com>
	(Jonathan Leto's message of "Mon, 8 Feb 2010 13:04:10 -0800")
References: <201002031627.20762.enobacon@gmail.com>
	<48bb92b1002050721v18eee88cs3c34ba1dff775ba9@mail.gmail.com>
	<9aaadf9c1002081304n5c823f0ck340b5d9db1c7955f@mail.gmail.com>
Message-ID: <86d40f1lhi.fsf@blue.stonehenge.com>

>>>>> "Jonathan" == Jonathan Leto <jaleto at gmail.com> writes:

Jonathan> or if you prefer git (you should), use my github mirror with

Jonathan> git clone git at github.com:leto/parrot.git

    Locohost.local:/Volumes/UFS/MIRROR % git clone git at github.com:leto/parrot.git
    Initialized empty Git repository in /Volumes/UFS/MIRROR/parrot/.git/
    Warning: Permanently added the RSA host key for IP address '207.97.227.239' to the list of known hosts.
    ERROR: Permission to leto/parrot denied to RandalSchwartz.
    fatal: The remote end hung up unexpectedly

I know, I'm specifically forbidden, eh?

-- 
Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
<merlyn at stonehenge.com> <URL:http://www.stonehenge.com/merlyn/>
Smalltalk/Perl/Unix consulting, Technical writing, Comedy, etc. etc.
See http://methodsandmessages.vox.com/ for Smalltalk and Seaside discussion

From merlyn at stonehenge.com  Mon Feb  8 13:13:42 2010
From: merlyn at stonehenge.com (Randal L. Schwartz)
Date: Mon, 08 Feb 2010 13:13:42 -0800
Subject: [Pdx-pm] Introduction to Parrot -- February meeting next Wed.
In-Reply-To: <86d40f1lhi.fsf@blue.stonehenge.com> (Randal L. Schwartz's
	message of "Mon, 08 Feb 2010 13:11:21 -0800")
References: <201002031627.20762.enobacon@gmail.com>
	<48bb92b1002050721v18eee88cs3c34ba1dff775ba9@mail.gmail.com>
	<9aaadf9c1002081304n5c823f0ck340b5d9db1c7955f@mail.gmail.com>
	<86d40f1lhi.fsf@blue.stonehenge.com>
Message-ID: <868wb31ldl.fsf@blue.stonehenge.com>

>>>>> "Randal" == Randal L Schwartz <merlyn at stonehenge.com> writes:

Jonathan> git clone git at github.com:leto/parrot.git

Ahh, works better if you use

  git clone git://github.com/leto/parrot.git

Note colon changed to dash.

-- 
Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
<merlyn at stonehenge.com> <URL:http://www.stonehenge.com/merlyn/>
Smalltalk/Perl/Unix consulting, Technical writing, Comedy, etc. etc.
See http://methodsandmessages.vox.com/ for Smalltalk and Seaside discussion

From jaleto at gmail.com  Mon Feb  8 13:14:17 2010
From: jaleto at gmail.com (Jonathan Leto)
Date: Mon, 8 Feb 2010 13:14:17 -0800
Subject: [Pdx-pm] Introduction to Parrot -- February meeting next Wed.
In-Reply-To: <86d40f1lhi.fsf@blue.stonehenge.com>
References: <201002031627.20762.enobacon@gmail.com>
	<48bb92b1002050721v18eee88cs3c34ba1dff775ba9@mail.gmail.com> 
	<9aaadf9c1002081304n5c823f0ck340b5d9db1c7955f@mail.gmail.com> 
	<86d40f1lhi.fsf@blue.stonehenge.com>
Message-ID: <9aaadf9c1002081314s1cb37c2fx46982fe6db5ce32f@mail.gmail.com>

Howdy,

OOPS! I gave out my private read-write github URL instead of the
read-only one. Here is the correct command:

git clone http://github.com/leto/parrot.git

Thanks for catching that, Randal!

Duke



On Mon, Feb 8, 2010 at 1:11 PM, Randal L. Schwartz
<merlyn at stonehenge.com> wrote:
>>>>>> "Jonathan" == Jonathan Leto <jaleto at gmail.com> writes:
>
> Jonathan> or if you prefer git (you should), use my github mirror with
>
> Jonathan> git clone git at github.com:leto/parrot.git
>
> ? ?Locohost.local:/Volumes/UFS/MIRROR % git clone git at github.com:leto/parrot.git
> ? ?Initialized empty Git repository in /Volumes/UFS/MIRROR/parrot/.git/
> ? ?Warning: Permanently added the RSA host key for IP address '207.97.227.239' to the list of known hosts.
> ? ?ERROR: Permission to leto/parrot denied to RandalSchwartz.
> ? ?fatal: The remote end hung up unexpectedly
>
> I know, I'm specifically forbidden, eh?
>
> --
> Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
> <merlyn at stonehenge.com> <URL:http://www.stonehenge.com/merlyn/>
> Smalltalk/Perl/Unix consulting, Technical writing, Comedy, etc. etc.
> See http://methodsandmessages.vox.com/ for Smalltalk and Seaside discussion
>



-- 
Jonathan "Duke" Leto
jonathan at leto.net
http://leto.net

From enobacon at gmail.com  Wed Feb 10 08:38:38 2010
From: enobacon at gmail.com (Seven till Seven)
Date: Wed, 10 Feb 2010 08:38:38 -0800
Subject: [Pdx-pm] meeting tonight:  Introduction to Parrot
Message-ID: <201002100838.39136.enobacon@gmail.com>

see http://pdx.pm.org/kwiki/

Wed. February 10th, 6:53pm at FreeGeek -- 1731 SE 10th Ave.

Introduction to Parrot Virtual Machine
speaker: Jonathan Leto

Come learn the basic things you need to know about Parrot Virtual 
Machine to start hacking on

 1) Parrot VM itself 
 2) Languages built on top of Parrot, High Level Languages (HLLs) 
 3) Projects and Libraries that use Parrot 

A short, down-to-earth introduction to the current state of Parrot will 
be followed by examples on how to hack on Parrot projects or how to 
start your own.

Having parrot installed on a laptop might be useful.
ftp://ftp.parrot.org/pub/parrot/releases/stable/2.0.0/parrot-2.0.0.tar.gz

You may also wish to read the Parrot Primer before the meeting.
http://docs.parrot.org/parrot/latest/html/docs/intro.pod.html


As always, the meeting will be followed by social hour at the LuckyLab. 
-- 

        http://pdx.pm.org

From ben.hengst at gmail.com  Wed Feb 10 18:57:08 2010
From: ben.hengst at gmail.com (benh)
Date: Wed, 10 Feb 2010 18:57:08 -0800
Subject: [Pdx-pm] Introduction to Parrot -- February meeting next Wed.
In-Reply-To: <9aaadf9c1002081314s1cb37c2fx46982fe6db5ce32f@mail.gmail.com>
References: <201002031627.20762.enobacon@gmail.com>
	<48bb92b1002050721v18eee88cs3c34ba1dff775ba9@mail.gmail.com>
	<9aaadf9c1002081304n5c823f0ck340b5d9db1c7955f@mail.gmail.com>
	<86d40f1lhi.fsf@blue.stonehenge.com>
	<9aaadf9c1002081314s1cb37c2fx46982fe6db5ce32f@mail.gmail.com>
Message-ID: <85ddf48b1002101857r447e36c9le116b94f2e4a879c@mail.gmail.com>

better to use:

git://github.com/leto/parrot.git



On Mon, Feb 8, 2010 at 13:14, Jonathan Leto <jaleto at gmail.com> wrote:
> Howdy,
>
> OOPS! I gave out my private read-write github URL instead of the
> read-only one. Here is the correct command:
>
> git clone http://github.com/leto/parrot.git
>
> Thanks for catching that, Randal!
>
> Duke
>
>
>
> On Mon, Feb 8, 2010 at 1:11 PM, Randal L. Schwartz
> <merlyn at stonehenge.com> wrote:
>>>>>>> "Jonathan" == Jonathan Leto <jaleto at gmail.com> writes:
>>
>> Jonathan> or if you prefer git (you should), use my github mirror with
>>
>> Jonathan> git clone git at github.com:leto/parrot.git
>>
>> ? ?Locohost.local:/Volumes/UFS/MIRROR % git clone git at github.com:leto/parrot.git
>> ? ?Initialized empty Git repository in /Volumes/UFS/MIRROR/parrot/.git/
>> ? ?Warning: Permanently added the RSA host key for IP address '207.97.227.239' to the list of known hosts.
>> ? ?ERROR: Permission to leto/parrot denied to RandalSchwartz.
>> ? ?fatal: The remote end hung up unexpectedly
>>
>> I know, I'm specifically forbidden, eh?
>>
>> --
>> Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
>> <merlyn at stonehenge.com> <URL:http://www.stonehenge.com/merlyn/>
>> Smalltalk/Perl/Unix consulting, Technical writing, Comedy, etc. etc.
>> See http://methodsandmessages.vox.com/ for Smalltalk and Seaside discussion
>>
>
>
>
> --
> Jonathan "Duke" Leto
> jonathan at leto.net
> http://leto.net
> _______________________________________________
> Pdx-pm-list mailing list
> Pdx-pm-list at pm.org
> http://mail.pm.org/mailman/listinfo/pdx-pm-list
>



-- 
benh~

http://three.sentenc.es/

From merlyn at stonehenge.com  Wed Feb 10 22:47:04 2010
From: merlyn at stonehenge.com (Randal L. Schwartz)
Date: Wed, 10 Feb 2010 22:47:04 -0800
Subject: [Pdx-pm] Jonathan Leto's Parrot talk from today
Message-ID: <86eikss1zr.fsf@blue.stonehenge.com>


Video is at http://www.ustream.tv/recorded/4630503 .

-- 
Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
<merlyn at stonehenge.com> <URL:http://www.stonehenge.com/merlyn/>
Smalltalk/Perl/Unix consulting, Technical writing, Comedy, etc. etc.
See http://methodsandmessages.vox.com/ for Smalltalk and Seaside discussion

From ben.hengst at gmail.com  Thu Feb 11 11:30:11 2010
From: ben.hengst at gmail.com (benh)
Date: Thu, 11 Feb 2010 11:30:11 -0800
Subject: [Pdx-pm] Jonathan Leto's Parrot talk from today
In-Reply-To: <86eikss1zr.fsf@blue.stonehenge.com>
References: <86eikss1zr.fsf@blue.stonehenge.com>
Message-ID: <85ddf48b1002111130i2736e4ap1cda989588c8e97e@mail.gmail.com>

Thanks Randal for the documentation.

On Wed, Feb 10, 2010 at 22:47, Randal L. Schwartz <merlyn at stonehenge.com> wrote:
>
> Video is at http://www.ustream.tv/recorded/4630503 .
>
> --
> Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
> <merlyn at stonehenge.com> <URL:http://www.stonehenge.com/merlyn/>
> Smalltalk/Perl/Unix consulting, Technical writing, Comedy, etc. etc.
> See http://methodsandmessages.vox.com/ for Smalltalk and Seaside discussion
> _______________________________________________
> Pdx-pm-list mailing list
> Pdx-pm-list at pm.org
> http://mail.pm.org/mailman/listinfo/pdx-pm-list
>



-- 
benh~

http://three.sentenc.es/

From kellert at ohsu.edu  Thu Feb 11 12:22:00 2010
From: kellert at ohsu.edu (Tom Keller)
Date: Thu, 11 Feb 2010 12:22:00 -0800
Subject: [Pdx-pm] bit wise comparison
Message-ID: <CB7B1F14-3965-4C62-85FD-3D16B9E0C98E@ohsu.edu>

Greetings,
A Bioperl list I'm on gave the following as a fast string comparison method:

#################################
$in = 'ACCTCCTCCTCGAGTATGTG';
$tgt = 'TATCTTGCGCCGGAGATAAT';
$mask = pack("A*",$in)^pack("A*",$tgt);
$matches = $mask =~ tr/"\x0"/"\x0"/;

Impressive! Not often you see pack() let alone exclusive-or with a
scalar context tr// thrown in for good measure!

For those who don't follow what it is doing, here is my (possibly
wrong) interpretation: The pack() is converting each of the two (equal
length) strings into a byte set. A bit-wise exclusive-or (XOR) is
performed between these two byte sets. This will create bytes of value
zero (0) where they were the same, and non-zero where they were
different. The tr// then counts how many of the bytes were zero (\x0
is ascii zero).
#################################

I can't get it to work on my machine. Would someone be able to help me with this?

For one thing, isn't ascii zero "x30" in hex? But even with that change, I get no return value for $matches in:
my $matches = $mask =~ tr/"\x30"/"\x30"/;

thanks,

Tom Keller
MMI DNA Services Core<http://www.ohsu.edu/xd/research/research-cores/dna-analysis/>
4-2442
kellert at ohsu edu<mailto:kellert at ohsu.edu>
RJH (CROET/BasicScience) 6339b





-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.pm.org/pipermail/pdx-pm-list/attachments/20100211/023469aa/attachment.html>

From enobacon at gmail.com  Thu Feb 11 13:35:31 2010
From: enobacon at gmail.com (Eric Wilhelm)
Date: Thu, 11 Feb 2010 13:35:31 -0800
Subject: [Pdx-pm] bit wise comparison
In-Reply-To: <CB7B1F14-3965-4C62-85FD-3D16B9E0C98E@ohsu.edu>
References: <CB7B1F14-3965-4C62-85FD-3D16B9E0C98E@ohsu.edu>
Message-ID: <201002111335.31063.enobacon@gmail.com>

# from Tom Keller
# on Thursday 11 February 2010 12:22:

>$in = 'ACCTCCTCCTCGAGTATGTG';
>$tgt = 'TATCTTGCGCCGGAGATAAT';
>$mask = pack("A*",$in)^pack("A*",$tgt);
>$matches = $mask =~ tr/"\x0"/"\x0"/;

I get warnings from the quotes (") in the tr//.  You *did* enable 
warnings, right?  :-D

An interesting, but slower trick would let you know where the matches 
are in a more straightforward way.

  $tgt =~ s/(.)/(?:($1)|.)/g;
  my @matches = $in =~ m/^$tgt/;

But why pack() ASCII characters into "A*" ASCII characters?  You should 
get a same and faster result with:

  my $mask = $in ^ $tgt;
  my $matches = $mask =~ tr/\x0//;

--Eric
-- 
"You can't win. You can't break even. You can't quit."
--Ginsberg's Restatement of the Three Laws of Thermodynamics
---------------------------------------------------
    http://scratchcomputing.com
---------------------------------------------------

From scfrd1 at gmail.com  Thu Feb 11 13:46:27 2010
From: scfrd1 at gmail.com (Steve Cayford)
Date: Thu, 11 Feb 2010 15:46:27 -0600
Subject: [Pdx-pm] bit wise comparison
In-Reply-To: <CB7B1F14-3965-4C62-85FD-3D16B9E0C98E@ohsu.edu>
References: <CB7B1F14-3965-4C62-85FD-3D16B9E0C98E@ohsu.edu>
Message-ID: <4B747AB3.7090107@gmail.com>

As far as I can tell, the pack commands are superfluous. They're just 
saying take this string and pack it into a string.

This works fine with the original strings...

print scalar(
     ("ACCTCCTCCTCGAGTATGTG" ^ "TATCTTGCGCCGGAGATAAT") =~ tr/\x0/\x0/
   ), "\n";

The tr/\x0/\x0/ is transliterating bytes that have zeroed out bits, not 
ASCII zeros.

-Steve

Tom Keller wrote:
> Greetings,
> A Bioperl list I'm on gave the following as a fast string comparison method:
> 
> #################################
>> $in = 'ACCTCCTCCTCGAGTATGTG';
>> $tgt = 'TATCTTGCGCCGGAGATAAT';
>> $mask = pack("A*",$in)^pack("A*",$tgt);
>> $matches = $mask =~ tr/"\x0"/"\x0"/;
> 
> Impressive! Not often you see pack() let alone exclusive-or with a
> scalar context tr// thrown in for good measure!
> 
> For those who don't follow what it is doing, here is my (possibly
> wrong) interpretation: The pack() is converting each of the two (equal
> length) strings into a byte set. A bit-wise exclusive-or (XOR) is
> performed between these two byte sets. This will create bytes of value
> zero (0) where they were the same, and non-zero where they were
> different. The tr// then counts how many of the bytes were zero (\x0
> is ascii zero).
> #################################
> 
> I can't get it to work on my machine. Would someone be able to help me 
> with this?
> 
> For one thing, isn't ascii zero "x30" in hex? But even with that change, 
> I get no return value for $matches in:
> my $matches = $mask =~ tr/"\x30"/"\x30"/;
> 
> thanks,
> 
> Tom Keller
> MMI DNA Services Core 
> <http://www.ohsu.edu/xd/research/research-cores/dna-analysis/>
> 4-2442
> kellert at ohsu edu <mailto:kellert at ohsu.edu>
> RJH (CROET/BasicScience) 6339b
> 
> 

From ben.prew at gmail.com  Thu Feb 11 16:10:03 2010
From: ben.prew at gmail.com (Ben Prew)
Date: Thu, 11 Feb 2010 16:10:03 -0800
Subject: [Pdx-pm] bit wise comparison
In-Reply-To: <4B747AB3.7090107@gmail.com>
References: <CB7B1F14-3965-4C62-85FD-3D16B9E0C98E@ohsu.edu> 
	<4B747AB3.7090107@gmail.com>
Message-ID: <24f4b2e81002111610o368b103cn8a7927d1ec45de03@mail.gmail.com>

Here's the original thread, it looks like the author was having
problems getting it working without the pack under Activestate 5.10

http://old.nabble.com/string-comparision-mismatches-and-matches-td27436645.html


On Thu, Feb 11, 2010 at 1:46 PM, Steve Cayford <scfrd1 at gmail.com> wrote:
> As far as I can tell, the pack commands are superfluous. They're just saying
> take this string and pack it into a string.
>
> This works fine with the original strings...
>
> print scalar(
> ? ?("ACCTCCTCCTCGAGTATGTG" ^ "TATCTTGCGCCGGAGATAAT") =~ tr/\x0/\x0/
> ?), "\n";
>
> The tr/\x0/\x0/ is transliterating bytes that have zeroed out bits, not
> ASCII zeros.
>
> -Steve
>
> Tom Keller wrote:
>>
>> Greetings,
>> A Bioperl list I'm on gave the following as a fast string comparison
>> method:
>>
>> #################################
>>>
>>> $in = 'ACCTCCTCCTCGAGTATGTG';
>>> $tgt = 'TATCTTGCGCCGGAGATAAT';
>>> $mask = pack("A*",$in)^pack("A*",$tgt);
>>> $matches = $mask =~ tr/"\x0"/"\x0"/;
>>
>> Impressive! Not often you see pack() let alone exclusive-or with a
>> scalar context tr// thrown in for good measure!
>>
>> For those who don't follow what it is doing, here is my (possibly
>> wrong) interpretation: The pack() is converting each of the two (equal
>> length) strings into a byte set. A bit-wise exclusive-or (XOR) is
>> performed between these two byte sets. This will create bytes of value
>> zero (0) where they were the same, and non-zero where they were
>> different. The tr// then counts how many of the bytes were zero (\x0
>> is ascii zero).
>> #################################
>>
>> I can't get it to work on my machine. Would someone be able to help me
>> with this?
>>
>> For one thing, isn't ascii zero "x30" in hex? But even with that change, I
>> get no return value for $matches in:
>> my $matches = $mask =~ tr/"\x30"/"\x30"/;
>>
>> thanks,
>>
>> Tom Keller
>> MMI DNA Services Core
>> <http://www.ohsu.edu/xd/research/research-cores/dna-analysis/>
>> 4-2442
>> kellert at ohsu edu <mailto:kellert at ohsu.edu>
>> RJH (CROET/BasicScience) 6339b
>>
>>
> _______________________________________________
> Pdx-pm-list mailing list
> Pdx-pm-list at pm.org
> http://mail.pm.org/mailman/listinfo/pdx-pm-list
>



-- 
--Ben

From MichaelRWolf at att.net  Thu Feb 11 18:39:59 2010
From: MichaelRWolf at att.net (Michael R. Wolf)
Date: Thu, 11 Feb 2010 18:39:59 -0800
Subject: [Pdx-pm] bit wise comparison
In-Reply-To: <4B747AB3.7090107@gmail.com>
References: <CB7B1F14-3965-4C62-85FD-3D16B9E0C98E@ohsu.edu>
	<4B747AB3.7090107@gmail.com>
Message-ID: <88B91730-8711-4DF7-9638-489DEAF7A11F@att.net>


On Feb 11, 2010, at 1:46 PM, Steve Cayford wrote:

> print scalar(
>    ("ACCTCCTCCTCGAGTATGTG" ^ "TATCTTGCGCCGGAGATAAT") =~ tr/\x0/\x0/
>  ), "\n";
>
> The tr/\x0/\x0/ is transliterating bytes that have zeroed out bits,  
> not ASCII zeros.

perldoc perlop says:
     It returns the number of characters replaced or deleted.

Since it's replacing something with itself, it's effectively counting  
those somethings (namely the NUL byte).

As to \x0...

Said another way, the original poster thought this code referred to  
'0', which *does* have a numeric value when passed through ord().  As  
Steve said ord('0') != 0.  Notice that the NUL character (numeric  
value 0) is not printable, but the zero character is...

perl -e 'printf "char: %s, decimal: %d, octal: 0%o, hex: 0x%x, binary:  
0b%b\n", chr($_), ($_)x4 foreach (0, map {ord} "0" .. "9")'
char: , decimal: 0, octal: 00, hex: 0x0, binary: 0b0
char: 0, decimal: 48, octal: 060, hex: 0x30, binary: 0b110000
char: 1, decimal: 49, octal: 061, hex: 0x31, binary: 0b110001
char: 2, decimal: 50, octal: 062, hex: 0x32, binary: 0b110010
char: 3, decimal: 51, octal: 063, hex: 0x33, binary: 0b110011
char: 4, decimal: 52, octal: 064, hex: 0x34, binary: 0b110100
char: 5, decimal: 53, octal: 065, hex: 0x35, binary: 0b110101
char: 6, decimal: 54, octal: 066, hex: 0x36, binary: 0b110110
char: 7, decimal: 55, octal: 067, hex: 0x37, binary: 0b110111
char: 8, decimal: 56, octal: 070, hex: 0x38, binary: 0b111000
char: 9, decimal: 57, octal: 071, hex: 0x39, binary: 0b111001


see also: ascii(7) on some unix-ish systems, copied below for  
incomplete systems (*nix and W32) -- best viewed at constant width  
font...;

      The octal set:

      000 nul  001 soh  002 stx  003 etx  004 eot  005 enq  006 ack   
007 bel
      010 bs   011 ht   012 nl   013 vt   014 np   015 cr   016 so    
017 si
      020 dle  021 dc1  022 dc2  023 dc3  024 dc4  025 nak  026 syn   
027 etb
      030 can  031 em   032 sub  033 esc  034 fs   035 gs   036 rs    
037 us
      040 sp   041  !   042  "   043  #   044  $   045  %   046  &    
047  '
      050  (   051  )   052  *   053  +   054  ,   055  -   056  .    
057  /
      060  0   061  1   062  2   063  3   064  4   065  5   066  6    
067  7
      070  8   071  9   072  :   073  ;   074  <   075  =   076  >    
077  ?
      100  @   101  A   102  B   103  C   104  D   105  E   106  F    
107  G
      110  H   111  I   112  J   113  K   114  L   115  M   116  N    
117  O
      120  P   121  Q   122  R   123  S   124  T   125  U   126  V    
127  W
      130  X   131  Y   132  Z   133  [   134  \   135  ]   136  ^    
137  _
      140  `   141  a   142  b   143  c   144  d   145  e   146  f    
147  g
      150  h   151  i   152  j   153  k   154  l   155  m   156  n    
157  o
      160  p   161  q   162  r   163  s   164  t   165  u   166  v    
167  w
      170  x   171  y   172  z   173  {   174  |   175  }   176  ~    
177 del

      The hexadecimal set:

      00 nul   01 soh   02 stx   03 etx   04 eot   05 enq   06 ack    
07 bel
      08 bs    09 ht    0a nl    0b vt    0c np    0d cr    0e so     
0f si
      10 dle   11 dc1   12 dc2   13 dc3   14 dc4   15 nak   16 syn    
17 etb
      18 can   19 em    1a sub   1b esc   1c fs    1d gs    1e rs     
1f us
      20 sp    21  !    22  "    23  #    24  $    25  %    26  &     
27  '
      28  (    29  )    2a  *    2b  +    2c  ,    2d  -    2e  .     
2f  /
      30  0    31  1    32  2    33  3    34  4    35  5    36  6     
37  7
      38  8    39  9    3a  :    3b  ;    3c  <    3d  =    3e  >     
3f  ?
      40  @    41  A    42  B    43  C    44  D    45  E    46  F     
47  G
      48  H    49  I    4a  J    4b  K    4c  L    4d  M    4e  N     
4f  O
      50  P    51  Q    52  R    53  S    54  T    55  U    56  V     
57  W
      58  X    59  Y    5a  Z    5b  [    5c  \    5d  ]    5e  ^     
5f  _
      60  `    61  a    62  b    63  c    64  d    65  e    66  f     
67  g
      68  h    69  i    6a  j    6b  k    6c  l    6d  m    6e  n     
6f  o
      70  p    71  q    72  r    73  s    74  t    75  u    76  v     
77  w
      78  x    79  y    7a  z    7b  {    7c  |    7d  }    7e  ~     
7f del

      The decimal set:

        0 nul    1 soh    2 stx    3 etx    4 eot    5 enq    6 ack     
7 bel
        8 bs     9 ht    10 nl    11 vt    12 np    13 cr    14 so     
15 si
       16 dle   17 dc1   18 dc2   19 dc3   20 dc4   21 nak   22 syn    
23 etb
       24 can   25 em    26 sub   27 esc   28 fs    29 gs    30 rs     
31 us
       32 sp    33  !    34  "    35  #    36  $    37  %    38  &     
39  '
       40  (    41  )    42  *    43  +    44  ,    45  -    46  .     
47  /
       48  0    49  1    50  2    51  3    52  4    53  5    54  6     
55  7
       56  8    57  9    58  :    59  ;    60  <    61  =    62  >     
63  ?
       64  @    65  A    66  B    67  C    68  D    69  E    70  F     
71  G
       72  H    73  I    74  J    75  K    76  L    77  M    78  N     
79  O
       80  P    81  Q    82  R    83  S    84  T    85  U    86  V     
87  W
       88  X    89  Y    90  Z    91  [    92  \    93  ]    94  ^     
95  _
       96  `    97  a    98  b    99  c   100  d   101  e   102  f    
103  g
      104  h   105  i   106  j   107  k   108  l   109  m   110  n    
111  o
      112  p   113  q   114  r   115  s   116  t   117  u   118  v    
119  w
      120  x   121  y   122  z   123  {   124  |   125  }   126  ~    
127 del


-- 
Michael R. Wolf
     All mammals learn by playing!
         MichaelRWolf at att.net





From MichaelRWolf at att.net  Thu Feb 11 18:49:24 2010
From: MichaelRWolf at att.net (Michael R. Wolf)
Date: Thu, 11 Feb 2010 18:49:24 -0800
Subject: [Pdx-pm] bit wise comparison
In-Reply-To: <201002111335.31063.enobacon@gmail.com>
References: <CB7B1F14-3965-4C62-85FD-3D16B9E0C98E@ohsu.edu>
	<201002111335.31063.enobacon@gmail.com>
Message-ID: <9A43F014-390A-4953-B25A-4DDEEA134FF5@att.net>


On Feb 11, 2010, at 1:35 PM, Eric Wilhelm wrote:

> # from Tom Keller
> # on Thursday 11 February 2010 12:22:
>
>> $in = 'ACCTCCTCCTCGAGTATGTG';
>> $tgt = 'TATCTTGCGCCGGAGATAAT';
>> $mask = pack("A*",$in)^pack("A*",$tgt);
>> $matches = $mask =~ tr/"\x0"/"\x0"/;
>
> I get warnings from the quotes (") in the tr//.  You *did* enable
> warnings, right?  :-D

tr's args are weird.

As written, the first arg has 3 characters: double-quote, NUL, double- 
quote.
So does the second arg.

Effectively, it's setting up this mapping
  "   =>   "
\x0 =>  \x0
"   =>  "

Maybe it's more obvious if you see it this way, another 3-arg to 3-arg  
transliteration:
   tr/abc/ABC/

The original is best written as a 1-arg to 1-arg:
tr/\x0/\x0/
  or
tr#\x0#\x0#
  or
tr{\x0}{\x0}


-- 
Michael R. Wolf
     All mammals learn by playing!
         MichaelRWolf at att.net





From jaleto at gmail.com  Thu Feb 11 23:59:06 2010
From: jaleto at gmail.com (Jonathan Leto)
Date: Thu, 11 Feb 2010 23:59:06 -0800
Subject: [Pdx-pm] Introduction to Parrot VM links
Message-ID: <9aaadf9c1002112359r6cf79239gc3834dceb9cb5943@mail.gmail.com>

Howdy,

Here are various digital representations of my recent "Introduction to
Parrot VM" talk:

mp3    : http://ping.fm/B8WHy
video  : http://ping.fm/7rGS5
slides : http://ping.fm/Qz4QO

Enjoy!


-- 
Jonathan "Duke" Leto
jonathan at leto.net
http://leto.net

From kellert at ohsu.edu  Thu Feb 18 11:04:59 2010
From: kellert at ohsu.edu (Tom Keller)
Date: Thu, 18 Feb 2010 11:04:59 -0800
Subject: [Pdx-pm] recursive IO::Dir
Message-ID: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>

Greetings,
I need to be able to process files within a directory tree. I know there is a module IO::Dir::Recursive, but I have trouble wrapping my brain around recursion, so I wanted to give it a try just using IO::Dir. This seems to do the recursion correctly:

#!/usr/bin/perl -w
use strict;
use IO::Dir;

my $source = $ARGV[0];
my $count;

process_dir($source);
print "$count files in all.\n";

sub check {
my ($dh,$path) = @_; ## dirhandle and path
while (defined($_ = $dh->read)) {
next if m/^\.+/; ## skip dot files
if ( -f "$path/$_" ) {
my $file = "$path/$_";
process_file($file);
} elsif ( -d "$path/$_" ) {
my $dir = "$path/$_";
process_dir($dir);
} else { print "unknown thing\n"; }
}
undef $dh;
}

sub process_file {
my $file = shift;
$count++;
}

sub process_dir {
my $path = shift;
my $dh = IO::Dir->new($path);
check($dh,$path);
}

## ... I'm guessing there's a better way, so I'm asking for feedback.

thanks,

Tom
kellert at ohsu.edu<mailto:kellert at ohsu.edu>
503-494-2442







-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.pm.org/pipermail/pdx-pm-list/attachments/20100218/7118e9a7/attachment.html>

From andy at petdance.com  Thu Feb 18 11:09:01 2010
From: andy at petdance.com (Andy Lester)
Date: Thu, 18 Feb 2010 13:09:01 -0600
Subject: [Pdx-pm] recursive IO::Dir
In-Reply-To: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
Message-ID: <01F342D3-2E7F-4782-9CFB-8EA0BA59C1A0@petdance.com>


On Feb 18, 2010, at 1:04 PM, Tom Keller wrote:

> I need to be able to process files within a directory tree. I know  
> there is a module IO::Dir::Recursive, but I have trouble wrapping my  
> brain around recursion, so I wanted to give it a try just using  
> IO::Dir. This seems to do the recursion correctly:
>


I'd like to suggest File::Next.

# This is from memory
use File::Next;
my $files = File::Next::files( $directory );
while ( defined my $file = $files->next ) {
     process_file( $file );
}

Butt simple, eh?

xoxo,
Andy

--
Andy Lester => andy at petdance.com => www.theworkinggeek.com => AIM:petdance





From enobacon at gmail.com  Thu Feb 18 11:40:41 2010
From: enobacon at gmail.com (Eric Wilhelm)
Date: Thu, 18 Feb 2010 11:40:41 -0800
Subject: [Pdx-pm] recursive IO::Dir
In-Reply-To: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
Message-ID: <201002181140.41500.enobacon@gmail.com>

# from Tom Keller
# on Thursday 18 February 2010 11:04:

>I need to be able to process files within a directory tree.

This will give you all of the files and directories under $topdir:

  my @paths = File::Fu->dir($topdir)->find(sub{1});

If your matcher sub returns true, the file is returned.  So for only the 
files:

  my @files = File::Fu->dir($topdir)->find(sub{$_->is_file});

The filenames returned are File::Fu::File objects relative to wherever 
$topdir is relative to (i.e. absolute if $topdir is absolute.)

If you want an iterator instead of one big list, you can use the 
finder() method.

  my $iter = File::Fu->dir($topdir)->finder(sub{1});

  while(defined(my $path = $iter->())) {
    $path or next;
    do_something_with($path);
  }

http://search.cpan.org/~ewilhelm/File-Fu-v0.0.6/lib/File/Fu/Dir.pm#finder

There is currently some better documentation for find(), finder(), and 
the knob in my svn trunk:

  http://svn.scratchcomputing.com/File-Fu/trunk/lib/File/Fu/Dir.pm

--Eric
-- 
Issues of control, repair, improvement, cost, or just plain
understandability all come down strongly in favor of open source
solutions to complex problems of any sort.
--Robert G. Brown
---------------------------------------------------
    http://scratchcomputing.com
---------------------------------------------------

From shlomif at iglu.org.il  Thu Feb 18 12:13:49 2010
From: shlomif at iglu.org.il (Shlomi Fish)
Date: Thu, 18 Feb 2010 22:13:49 +0200
Subject: [Pdx-pm] recursive IO::Dir
In-Reply-To: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
Message-ID: <201002182213.49442.shlomif@iglu.org.il>

Hi Tom,

On Thursday 18 Feb 2010 21:04:59 Tom Keller wrote:
> Greetings,
> I need to be able to process files within a directory tree. I know there is
> a module IO::Dir::Recursive, but I have trouble wrapping my brain around
> recursion, so I wanted to give it a try just using IO::Dir. This seems to
> do the recursion correctly:
> 

I would suggest using a directory traversal module such as File-Find-Object:

http://www.shlomifish.org/open-source/projects/File-Find-Object/

It was created and developed as a better and saner alternative to the 
File::Find module which is distributed with perl 5, and there are other 
similar modules mentioned on its CPAN page:

http://search.cpan.org/perldoc?File::Find::Object

Also see all the links there.

Regards,

	Shlomi Fish

-- 
-----------------------------------------------------------------
Shlomi Fish       http://www.shlomifish.org/
List of Portability Libraries - http://shlom.in/port-libs

Deletionists delete Wikipedia articles that they consider lame.
Chuck Norris deletes deletionists whom he considers lame.

Please reply to list if it's a mailing list post - http://shlom.in/reply .

From jaleto at gmail.com  Thu Feb 18 12:20:47 2010
From: jaleto at gmail.com (Jonathan Leto)
Date: Thu, 18 Feb 2010 12:20:47 -0800
Subject: [Pdx-pm] recursive IO::Dir
In-Reply-To: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
Message-ID: <9aaadf9c1002181220v33d2a331gaab5f3eecc3bb0ec@mail.gmail.com>

Howdy,

As if you needed more possible solutions, there is File::Finder as well:

http://search.cpan.org/dist/File-Finder/

Duke



2010/2/18 Tom Keller <kellert at ohsu.edu>:
> Greetings,
> I need to be able to process files within a directory tree.?I know there is
> a module IO::Dir::Recursive, but I have trouble wrapping my brain around
> recursion, so I wanted to give it a try?just using IO::Dir. This seems to do
> the recursion correctly:
> #!/usr/bin/perl -w
> use strict;
> use IO::Dir;
> my $source = $ARGV[0];
> my $count;
> process_dir($source);
> print "$count files in all.\n";
> sub check {
> my ($dh,$path) = @_; ## dirhandle and path
> while (defined($_ = $dh->read)) {
> next if m/^\.+/; ## skip dot files
> if ( -f "$path/$_" ) {
> my $file = "$path/$_";
> process_file($file);
> } elsif ( -d "$path/$_" ) {
> my $dir = "$path/$_";
> process_dir($dir);
> } else { print "unknown thing\n"; }
> }
> undef $dh;
> }
> sub process_file {
> my $file = shift;
> $count++;
> }
> sub process_dir {
> my $path = shift;
> my $dh = IO::Dir->new($path);
> check($dh,$path);
> }
> ##?... I'm guessing there's a better way, so I'm asking for feedback.
> thanks,
> Tom
> kellert at ohsu.edu
> 503-494-2442
>
>
>
>
>
>
>
> _______________________________________________
> Pdx-pm-list mailing list
> Pdx-pm-list at pm.org
> http://mail.pm.org/mailman/listinfo/pdx-pm-list
>



-- 
Jonathan "Duke" Leto
jonathan at leto.net
http://leto.net

From tkil at scrye.com  Thu Feb 18 12:41:42 2010
From: tkil at scrye.com (Tkil)
Date: Thu, 18 Feb 2010 13:41:42 -0700
Subject: [Pdx-pm] recursive IO::Dir
In-Reply-To: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu> (Tom Keller's
	message of "Thu, 18 Feb 2010 11:04:59 -0800")
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
Message-ID: <gpr42wa2h.fsf@dworkin.scrye.com>

>>>>> "Tom" == Tom Keller <kellert at ohsu.edu> writes:

Tom> I need to be able to process files within a directory tree. I
Tom> know there is a module IO::Dir::Recursive, but I have trouble
Tom> wrapping my brain around recursion, so I wanted to give it a try
Tom> just using IO::Dir.

I'm amused that you did end up with recursion anyway ("process_dir"
calls "check" which can call "process_dir").  If you really want to
avoid recursion, you want to do a breadth-first search and maintain a
queue of directories to examine... but I'd advise against writing your
own directory traversal code, regardless.

One advantage to using good old File::Find is that it's available on
every perl5 install for ... gah, 15+ years now?  It also handles some
things that could trip you up if you try to write it yourself, e.g.,
symlinks that create circular loops.

Dead simple for what you want to do, too:

| #!/usr/bin/perl
| 
| use strict;
| use warnings;
| 
| use File::Find qw();
| 
| # the routine that looks at each file; for demonstration purposes,
| # it'll just give the size.  by default, File::Find::find changes into
| # each directory as goes, and $_ is just the basename.  to display the
| # full name, we use the full-qualified variable $File::Find::name.
| sub process_file
| {
|     my ( $file ) = @_;
|     print "$File::Find::name: ", ( -s $file ), " bytes\n";
| }
| 
| # assume that @ARGV holds the dirs we want to examine.
| File::Find::find( sub { process_file $_ if -f $_ },
|                   @ARGV );
| 
| exit 0;

Happy hacking,
t.

From erik at hollensbe.org  Thu Feb 18 12:41:44 2010
From: erik at hollensbe.org (Erik Hollensbe)
Date: Thu, 18 Feb 2010 15:41:44 -0500
Subject: [Pdx-pm] recursive IO::Dir
In-Reply-To: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
Message-ID: <4B7DA608.3020303@hollensbe.org>

Instead of plugging my own software, I'll mention File::Find because no 
one has yet. It should already be on your system.

On 02/18/10 14:04, Tom Keller wrote:
> Greetings,
> I need to be able to process files within a directory tree. I know 
> there is a module IO::Dir::Recursive, but I have trouble wrapping my 
> brain around recursion, so I wanted to give it a try just using 
> IO::Dir. This seems to do the recursion correctly:
>
> #!/usr/bin/perl -w
> use strict;
> use IO::Dir;
>
> my $source = $ARGV[0];
> my $count;
>
> process_dir($source);
> print "$count files in all.\n";
>
> sub check {
> my ($dh,$path) = @_; ## dirhandle and path
> while (defined($_ = $dh->read)) {
> next if m/^\.+/; ## skip dot files
> if ( -f "$path/$_" ) {
> my $file = "$path/$_";
> process_file($file);
> } elsif ( -d "$path/$_" ) {
> my $dir = "$path/$_";
> process_dir($dir);
> } else { print "unknown thing\n"; }
> }
> undef $dh;
> }
>
> sub process_file {
> my $file = shift;
> $count++;
> }
>
> sub process_dir {
> my $path = shift;
> my $dh = IO::Dir->new($path);
> check($dh,$path);
> }
>
> ## ... I'm guessing there's a better way, so I'm asking for feedback.
>
> thanks,
>
> Tom
> kellert at ohsu.edu <mailto:kellert at ohsu.edu>
> 503-494-2442
>
>
>
>
>
>
>
>
> _______________________________________________
> Pdx-pm-list mailing list
> Pdx-pm-list at pm.org
> http://mail.pm.org/mailman/listinfo/pdx-pm-list

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.pm.org/pipermail/pdx-pm-list/attachments/20100218/02e64547/attachment.html>

From andy at petdance.com  Thu Feb 18 12:47:10 2010
From: andy at petdance.com (Andy Lester)
Date: Thu, 18 Feb 2010 14:47:10 -0600
Subject: [Pdx-pm] recursive IO::Dir
In-Reply-To: <4B7DA608.3020303@hollensbe.org>
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
	<4B7DA608.3020303@hollensbe.org>
Message-ID: <E253DD72-8F0D-4B8F-822E-0663B8913173@petdance.com>


On Feb 18, 2010, at 2:41 PM, Erik Hollensbe wrote:

> Instead of plugging my own software, I'll mention File::Find because  
> no one has yet. It should already be on your system.


No, go ahead, plug your software.  What file digging module is yours?

xoox,
Andy

--
Andy Lester => andy at petdance.com => www.theworkinggeek.com => AIM:petdance





From erik at hollensbe.org  Thu Feb 18 12:55:00 2010
From: erik at hollensbe.org (Erik Hollensbe)
Date: Thu, 18 Feb 2010 15:55:00 -0500
Subject: [Pdx-pm] recursive IO::Dir
In-Reply-To: <E253DD72-8F0D-4B8F-822E-0663B8913173@petdance.com>
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
	<4B7DA608.3020303@hollensbe.org>
	<E253DD72-8F0D-4B8F-822E-0663B8913173@petdance.com>
Message-ID: <4B7DA924.8090806@hollensbe.org>

On 02/18/10 15:47, Andy Lester wrote:
>
> On Feb 18, 2010, at 2:41 PM, Erik Hollensbe wrote:
>
>> Instead of plugging my own software, I'll mention File::Find because 
>> no one has yet. It should already be on your system.
>
>
> No, go ahead, plug your software.  What file digging module is yours?

package My::FileDiggingModule;

use strict;
use warnings;

use File::Find qw(find);

sub find_a_directory { -d }

sub gotta_catch_them_all {
   find(\&find_a_directory, @_);
}

q(how do you like them apples?);

-Erik

From kellert at ohsu.edu  Thu Feb 18 13:09:05 2010
From: kellert at ohsu.edu (Tom Keller)
Date: Thu, 18 Feb 2010 13:09:05 -0800
Subject: [Pdx-pm] recursive IO::Dir alternatives
In-Reply-To: <201002181140.41500.enobacon@gmail.com>
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
	<201002181140.41500.enobacon@gmail.com>
Message-ID: <478E4793-3F9D-464D-A376-5C093CB910A1@ohsu.edu>

Summary for modules to traverse a directory tree:
0. q(don't roll your own. ... I know that, just needed the exercise.)
1. File::Next
2. File::Fu
3. File::Find::Object
4. File::Finder
5. File::Find

thanks,
Tom
kellert at ohsu.edu<mailto:kellert at ohsu.edu>
503-494-2442







On Feb 18, 2010, at 11:40 AM, Eric Wilhelm wrote:

# from Tom Keller
# on Thursday 18 February 2010 11:04:

I need to be able to process files within a directory tree.

This will give you all of the files and directories under $topdir:

 my @paths = File::Fu->dir($topdir)->find(sub{1});

If your matcher sub returns true, the file is returned.  So for only the
files:

 my @files = File::Fu->dir($topdir)->find(sub{$_->is_file});

The filenames returned are File::Fu::File objects relative to wherever
$topdir is relative to (i.e. absolute if $topdir is absolute.)

If you want an iterator instead of one big list, you can use the
finder() method.

 my $iter = File::Fu->dir($topdir)->finder(sub{1});

 while(defined(my $path = $iter->())) {
   $path or next;
   do_something_with($path);
 }

http://search.cpan.org/~ewilhelm/File-Fu-v0.0.6/lib/File/Fu/Dir.pm#finder

There is currently some better documentation for find(), finder(), and
the knob in my svn trunk:

 http://svn.scratchcomputing.com/File-Fu/trunk/lib/File/Fu/Dir.pm

--Eric
--
Issues of control, repair, improvement, cost, or just plain
understandability all come down strongly in favor of open source
solutions to complex problems of any sort.
--Robert G. Brown
---------------------------------------------------
   http://scratchcomputing.com
---------------------------------------------------
_______________________________________________
Pdx-pm-list mailing list
Pdx-pm-list at pm.org
http://mail.pm.org/mailman/listinfo/pdx-pm-list

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.pm.org/pipermail/pdx-pm-list/attachments/20100218/6e261f23/attachment-0001.html>

From merlyn at stonehenge.com  Thu Feb 18 13:20:01 2010
From: merlyn at stonehenge.com (Randal L. Schwartz)
Date: Thu, 18 Feb 2010 13:20:01 -0800
Subject: [Pdx-pm] recursive IO::Dir
In-Reply-To: <9aaadf9c1002181220v33d2a331gaab5f3eecc3bb0ec@mail.gmail.com>
	(Jonathan Leto's message of "Thu, 18 Feb 2010 12:20:47 -0800")
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
	<9aaadf9c1002181220v33d2a331gaab5f3eecc3bb0ec@mail.gmail.com>
Message-ID: <86vddu9r7i.fsf@blue.stonehenge.com>

>>>>> "Jonathan" == Jonathan Leto <jaleto at gmail.com> writes:

Jonathan> http://search.cpan.org/dist/File-Finder/

I also happen to be partial to that module.  It works the way I think
a module like this should work.

Oh, yeah, no wonder.  I wrote it. :)

-- 
Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
<merlyn at stonehenge.com> <URL:http://www.stonehenge.com/merlyn/>
Smalltalk/Perl/Unix consulting, Technical writing, Comedy, etc. etc.
See http://methodsandmessages.vox.com/ for Smalltalk and Seaside discussion

From jkeroes at gmail.com  Thu Feb 18 13:24:01 2010
From: jkeroes at gmail.com (Joshua Keroes)
Date: Thu, 18 Feb 2010 13:24:01 -0800
Subject: [Pdx-pm] recursive IO::Dir alternatives
In-Reply-To: <478E4793-3F9D-464D-A376-5C093CB910A1@ohsu.edu>
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu> 
	<201002181140.41500.enobacon@gmail.com>
	<478E4793-3F9D-464D-A376-5C093CB910A1@ohsu.edu>
Message-ID: <c67b68201002181324s6d7b209bs4751ca2f1c91b93b@mail.gmail.com>

I've used File::Find::Rule with success. That said, I like File::Next's nice
clean interface.

Completely OT: zsh has a builtin globbing operator, **, that means "this
directory and below". For example,

  find . -name "file*" -print

would look like the following in zsh land:

  ls **/file*

And any command works on the file lists, ls is just the tip of the iceberg.
I <3 my new shell.

2010/2/18 Tom Keller <kellert at ohsu.edu>

> Summary for modules to traverse a directory tree:
> 0. q(don't roll your own. ... I know that, just needed the exercise.)
> 1. File::Next
> 2. File::Fu
> 3. File::Find::Object
> 4. File::Finder
> 5. File::Find
>
> thanks,
>     Tom
> kellert at ohsu.edu
> 503-494-2442
>
>
>
>
>
>
>
> On Feb 18, 2010, at 11:40 AM, Eric Wilhelm wrote:
>
> # from Tom Keller
> # on Thursday 18 February 2010 11:04:
>
> I need to be able to process files within a directory tree.
>
>
> This will give you all of the files and directories under $topdir:
>
>  my @paths = File::Fu->dir($topdir)->find(sub{1});
>
> If your matcher sub returns true, the file is returned.  So for only the
> files:
>
>  my @files = File::Fu->dir($topdir)->find(sub{$_->is_file});
>
> The filenames returned are File::Fu::File objects relative to wherever
> $topdir is relative to (i.e. absolute if $topdir is absolute.)
>
> If you want an iterator instead of one big list, you can use the
> finder() method.
>
>  my $iter = File::Fu->dir($topdir)->finder(sub{1});
>
>  while(defined(my $path = $iter->())) {
>    $path or next;
>    do_something_with($path);
>  }
>
> http://search.cpan.org/~ewilhelm/File-Fu-v0.0.6/lib/File/Fu/Dir.pm#finder
>
> There is currently some better documentation for find(), finder(), and
> the knob in my svn trunk:
>
>  http://svn.scratchcomputing.com/File-Fu/trunk/lib/File/Fu/Dir.pm
>
> --Eric
> --
> Issues of control, repair, improvement, cost, or just plain
> understandability all come down strongly in favor of open source
> solutions to complex problems of any sort.
> --Robert G. Brown
> ---------------------------------------------------
>    http://scratchcomputing.com
> ---------------------------------------------------
> _______________________________________________
> Pdx-pm-list mailing list
> Pdx-pm-list at pm.org
> http://mail.pm.org/mailman/listinfo/pdx-pm-list
>
>
>
> _______________________________________________
> Pdx-pm-list mailing list
> Pdx-pm-list at pm.org
> http://mail.pm.org/mailman/listinfo/pdx-pm-list
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.pm.org/pipermail/pdx-pm-list/attachments/20100218/be53bd23/attachment.html>

From peter at psdt.com  Thu Feb 18 18:28:35 2010
From: peter at psdt.com (Peter Scott)
Date: Thu, 18 Feb 2010 18:28:35 -0800
Subject: [Pdx-pm] recursive IO::Dir
In-Reply-To: <4B7DA924.8090806@hollensbe.org>
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
	<4B7DA608.3020303@hollensbe.org>
	<E253DD72-8F0D-4B8F-822E-0663B8913173@petdance.com>
	<4B7DA924.8090806@hollensbe.org>
Message-ID: <p06230900c7a3a64419df@[192.168.1.2]>

There's more than 17 ways to do it:

$ perl -MIO::All -le '$io=io("."); print for $io->All'

From bruce at drangle.com  Fri Feb 19 09:57:26 2010
From: bruce at drangle.com (Bruce Keeler)
Date: Fri, 19 Feb 2010 09:57:26 -0800
Subject: [Pdx-pm] recursive IO::Dir alternatives
In-Reply-To: <c67b68201002181324s6d7b209bs4751ca2f1c91b93b@mail.gmail.com>
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
	<201002181140.41500.enobacon@gmail.com>	<478E4793-3F9D-464D-A376-5C093CB910A1@ohsu.edu>
	<c67b68201002181324s6d7b209bs4751ca2f1c91b93b@mail.gmail.com>
Message-ID: <4B7ED106.40008@drangle.com>

On 2/18/2010 1:24 PM, Joshua Keroes wrote:
> I've used File::Find::Rule with success. That said, I like 
> File::Next's nice clean interface.
>
> Completely OT: zsh has a builtin globbing operator, **, that means 
> "this directory and below". For example,
>
>   find . -name "file*" -print
>
> would look like the following in zsh land:
>
>   ls **/file*
>
> And any command works on the file lists, ls is just the tip of the 
> iceberg. I <3 my new shell.
>

Welcome to the zsh fan club; I've been a member since '91! I've no idea 
why the world is all hung up on the vastly inferior bash.

From ingy at ingy.net  Fri Feb 19 13:04:40 2010
From: ingy at ingy.net (Ingy dot Net)
Date: Fri, 19 Feb 2010 13:04:40 -0800
Subject: [Pdx-pm] recursive IO::Dir alternatives
In-Reply-To: <478E4793-3F9D-464D-A376-5C093CB910A1@ohsu.edu>
References: <A4D7D0BA-DA04-4BC3-8613-89A9497CAD70@ohsu.edu>
	<201002181140.41500.enobacon@gmail.com>
	<478E4793-3F9D-464D-A376-5C093CB910A1@ohsu.edu>
Message-ID: <9eb4914f1002191304h7b8960f6rbf363feb806448a8@mail.gmail.com>

IO::All works too. Here's some tasty idioms taken from the doc page:

           # Read all the files/directories in a directory:
           $io = io('my/directory/');                  # Create new
directory object
           @contents = $io->all;                       # Get all contents of
dir
           @contents = @$io;                           # Directory as an
array
           @contents = values %$io;                    # Directory as a hash
           push @contents, $subdir                     # One at a time
             while $subdir = $io->next;

           # Print the name and file type for all the contents above:
           print "$_ is a " . $_->type . "\n"          # Each element of
@contents
             for @contents;                            # is an IO::All
object!!

           # Print first line of each file:
           print $_->getline                           # getline gets one
line
             for io('dir')->all_files;                 # Files only

           # Print names of all files/dirs three directories deep:
           print "$_\n" for $io->all(3);               # Pass in the depth.
Default=1

           # Print names of all files/dirs recursively:
           print "$_\n" for $io->all(0);               # Zero means all the
way down
           print "$_\n" for $io->All;                  # Capitalized
shortcut
           print "$_\n" for $io->deep->all;            # Another way


2010/2/18 Tom Keller <kellert at ohsu.edu>

> Summary for modules to traverse a directory tree:
> 0. q(don't roll your own. ... I know that, just needed the exercise.)
> 1. File::Next
> 2. File::Fu
> 3. File::Find::Object
> 4. File::Finder
> 5. File::Find
>
> thanks,
> Tom
> kellert at ohsu.edu
> 503-494-2442
>
>
>
>
>
>
>
> On Feb 18, 2010, at 11:40 AM, Eric Wilhelm wrote:
>
> # from Tom Keller
> # on Thursday 18 February 2010 11:04:
>
> I need to be able to process files within a directory tree.
>
>
> This will give you all of the files and directories under $topdir:
>
>  my @paths = File::Fu->dir($topdir)->find(sub{1});
>
> If your matcher sub returns true, the file is returned.  So for only the
> files:
>
>  my @files = File::Fu->dir($topdir)->find(sub{$_->is_file});
>
> The filenames returned are File::Fu::File objects relative to wherever
> $topdir is relative to (i.e. absolute if $topdir is absolute.)
>
> If you want an iterator instead of one big list, you can use the
> finder() method.
>
>  my $iter = File::Fu->dir($topdir)->finder(sub{1});
>
>  while(defined(my $path = $iter->())) {
>    $path or next;
>    do_something_with($path);
>  }
>
> http://search.cpan.org/~ewilhelm/File-Fu-v0.0.6/lib/File/Fu/Dir.pm#finder
>
> There is currently some better documentation for find(), finder(), and
> the knob in my svn trunk:
>
>  http://svn.scratchcomputing.com/File-Fu/trunk/lib/File/Fu/Dir.pm
>
> --Eric
> --
> Issues of control, repair, improvement, cost, or just plain
> understandability all come down strongly in favor of open source
> solutions to complex problems of any sort.
> --Robert G. Brown
> ---------------------------------------------------
>    http://scratchcomputing.com
> ---------------------------------------------------
> _______________________________________________
> Pdx-pm-list mailing list
> Pdx-pm-list at pm.org
> http://mail.pm.org/mailman/listinfo/pdx-pm-list
>
>
>
> _______________________________________________
> Pdx-pm-list mailing list
> Pdx-pm-list at pm.org
> http://mail.pm.org/mailman/listinfo/pdx-pm-list
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.pm.org/pipermail/pdx-pm-list/attachments/20100219/86513ad7/attachment.html>

From ben.hengst at gmail.com  Mon Feb 22 15:35:26 2010
From: ben.hengst at gmail.com (benh)
Date: Mon, 22 Feb 2010 15:35:26 -0800
Subject: [Pdx-pm] defined $var->{key} changes $var in to a hashref?
Message-ID: <85ddf48b1002221535k7618563ey785d5d9b6952936d@mail.gmail.com>

is this expected? run under perl 5.10.0 :

#!/usr/bin/perl

use strict;
use warnings;

use Test::Most qw{no_plan};

my $var;

eq_or_diff( $var, undef );

ok( ! defined $var->{key} );

eq_or_diff( $var, undef );

__END__
ok 1
ok 2
not ok 3
#   Failed test at /tmp/mystry_hash.t line 14.
# +----+-----+----------+
# | Elt|Got  |Expected  |
# +----+-----+----------+
# *   0|{}   |undef     *
# +----+-----+----------+
1..3
# Looks like you failed 1 test of 3.


-- 
benh~

http://three.sentenc.es/

From andy at petdance.com  Mon Feb 22 15:37:44 2010
From: andy at petdance.com (Andy Lester)
Date: Mon, 22 Feb 2010 17:37:44 -0600
Subject: [Pdx-pm] defined $var->{key} changes $var in to a hashref?
In-Reply-To: <85ddf48b1002221535k7618563ey785d5d9b6952936d@mail.gmail.com>
References: <85ddf48b1002221535k7618563ey785d5d9b6952936d@mail.gmail.com>
Message-ID: <51D8FF40-06FE-4054-BE99-3981945BC9A2@petdance.com>


On Feb 22, 2010, at 5:35 PM, benh wrote:

> eq_or_diff( $var, undef );
> 
> ok( ! defined $var->{key} );
> 
> eq_or_diff( $var, undef );

Yes, because you're forcing $var to be a hashref because you want to get something out of it.  You want to check to see if it's a hashref first.

--
Andy Lester => andy at petdance.com => www.theworkinggeek.com => AIM:petdance





From ben.hengst at gmail.com  Mon Feb 22 15:47:34 2010
From: ben.hengst at gmail.com (benh)
Date: Mon, 22 Feb 2010 15:47:34 -0800
Subject: [Pdx-pm] defined $var->{key} changes $var in to a hashref?
In-Reply-To: <51D8FF40-06FE-4054-BE99-3981945BC9A2@petdance.com>
References: <85ddf48b1002221535k7618563ey785d5d9b6952936d@mail.gmail.com>
	<51D8FF40-06FE-4054-BE99-3981945BC9A2@petdance.com>
Message-ID: <85ddf48b1002221547u26be60fdy75eb8af9505c3eb9@mail.gmail.com>

ok I guess I should rephrase, I understand ~why~ it's doing this
($var->{} builds out the hash, not defined), but it's not quite what
my ~expectation~ was. What I was thinking was going to happen was more
along the lines of:

grep{$x = $_; $x->{key}} $var

so that $var was not touched... though I can't think of a good way for
defined to effectively clone in place as the transformation would have
already happened as far as defined was concerned.

On Mon, Feb 22, 2010 at 15:37, Andy Lester <andy at petdance.com> wrote:
>
> On Feb 22, 2010, at 5:35 PM, benh wrote:
>
>> eq_or_diff( $var, undef );
>>
>> ok( ! defined $var->{key} );
>>
>> eq_or_diff( $var, undef );
>
> Yes, because you're forcing $var to be a hashref because you want to get something out of it. ?You want to check to see if it's a hashref first.
>
> --
> Andy Lester => andy at petdance.com => www.theworkinggeek.com => AIM:petdance
>
>
>
>
>



-- 
benh~

http://three.sentenc.es/

From schwern at pobox.com  Mon Feb 22 16:21:15 2010
From: schwern at pobox.com (Michael G Schwern)
Date: Mon, 22 Feb 2010 16:21:15 -0800
Subject: [Pdx-pm] defined $var->{key} changes $var in to a hashref?
In-Reply-To: <85ddf48b1002221547u26be60fdy75eb8af9505c3eb9@mail.gmail.com>
References: <85ddf48b1002221535k7618563ey785d5d9b6952936d@mail.gmail.com>
	<51D8FF40-06FE-4054-BE99-3981945BC9A2@petdance.com>
	<85ddf48b1002221547u26be60fdy75eb8af9505c3eb9@mail.gmail.com>
Message-ID: <4B831F7B.7000300@pobox.com>

benh wrote:
> ok I guess I should rephrase, I understand ~why~ it's doing this
> ($var->{} builds out the hash, not defined), but it's not quite what
> my ~expectation~ was. What I was thinking was going to happen was more
> along the lines of:
> 
> grep{$x = $_; $x->{key}} $var
> 
> so that $var was not touched... though I can't think of a good way for
> defined to effectively clone in place as the transformation would have
> already happened as far as defined was concerned.

Welcome to the Wonderful World of Autovivification.  Generally considered to 
be a bug, or an overzealous feature, in cases where it vivifies just to check 
if something exists.  Unfortunately, it was ill defined and is considered too 
ingrained into Perl to change.

autovivification.pm can control this behavior lexically.  perl5i comes with 
"no autovivification" built in.


-- 
54. "Napalm sticks to kids" is *not* a motivational phrase.
     -- The 213 Things Skippy Is No Longer Allowed To Do In The U.S. Army
            http://skippyslist.com/list/

From enobacon at gmail.com  Tue Feb 23 12:07:52 2010
From: enobacon at gmail.com (Eric Wilhelm)
Date: Tue, 23 Feb 2010 12:07:52 -0800
Subject: [Pdx-pm] Perl 6 talk at westside
Message-ID: <201002231207.52139.enobacon@gmail.com>

Hi all,

I'm giving a Perl 6 talk at the westside programmers group this 
Thursday.  Please come heckle me.

  http://calagator.org/events/1250458344

The OTBC is right at the "The Round" stop on the max blue line (one stop 
west of beaverton transit center.)

Thanks,
Eric
-- 
The opinions expressed in this e-mail were randomly generated by
the computer and do not necessarily reflect the views of its owner.
--Management
---------------------------------------------------
    http://scratchcomputing.com
---------------------------------------------------

From enobacon at gmail.com  Wed Feb 24 18:39:57 2010
From: enobacon at gmail.com (Seven till Seven)
Date: Wed, 24 Feb 2010 18:39:57 -0800
Subject: [Pdx-pm] XML with Xtra X -- March meeting in 2 weeks
Message-ID: <201002241839.57129.enobacon@gmail.com>

see http://pdx.pm.org/kwiki/

How to learn to parse huge XML documents by doing it wrong for 5 years
Speaker: Tyler Riddle 

 When XML documents can't fit into memory the vast majority of solutions 
available on CPAN are no longer available to you; when the XML 
documents are so large they take up to 16 hours to process with the 
standard tools for handling large documents your hands are tied even 
more. Tyler will cover his learning experiences creating the 
Parse::MediaWikiDump and MediaWiki::DumpFile modules which are made to 
handle the 24 gigabyte English Wikipedia dump files in a reasonable 
time frame.

 1) Real world benchmarks of C and perl libraries used to process huge
    XML documents. 

 2) The dirty little secret about XS and what it means for you in this
    context. 

 3) The evolution of the implementation of a nice interface around event
    oriented (SAX style) XML parsing. 

 4) Why XML::LibXML::Reader and XML::CompactTree are your friends and
    how to tame them.


As always, the meeting will be followed by social hour at the LuckyLab. 
-- 

        http://pdx.pm.org