From dan at linder.org  Sun Nov  1 20:12:43 2009
From: dan at linder.org (Dan Linder)
Date: Sun, 1 Nov 2009 23:12:43 -0500
Subject: [Omaha.pm] Self monitoring a perl scripts memory usage...
In-Reply-To: <016EDC3F-2911-4258-9AC6-35AE429B5829@jays.net>
References: <3e2be50910211217o50073897nc0570dc073d4e548@mail.gmail.com> 
	<8FB7FD39-F9D2-4340-A2F6-7804F6AB2389@jays.net>
	<3e2be50910281210s4e088cdcl438df6c26710d2bf@mail.gmail.com> 
	<016EDC3F-2911-4258-9AC6-35AE429B5829@jays.net>
Message-ID: <3e2be50911012012v747a02d3y93aa583cd8c0d426@mail.gmail.com>

On Sat, Oct 31, 2009 at 09:10, Jay Hannah <jay at jays.net> wrote:
> As you process each user/group you can't Cache::FileCache it or shove it
> into a database or something?

That's one possibility.  What I'd like to do is query the ulimit
values at startup, then periodically monitor the size of the variables
(combination of hashes & arrays), and if the memory used reaches a
high-water mark it writes a note to the logfile and then quits
processing right there.  I'd leave it up to the end user to up the
ulimit or high-watermark  settings if they want to process further.

A quick Google for "perl variable size" shows that length() can work
well for scalar variables and can be coaxed into returning the size in
bytes, but doesn't work for hashes and arrays.  It looks like the
"Devel::Size" module is needed for that, but it's not part of the Perl
core module set.  (And some of the comments on PerlMonks.org leads me
to believe it might not be all that stable either...)

I could use Data::Dumper to produce a textual reference stored in a
scalar variable then get it's size.  I'd get a bit of extraneous
characters (i.e. {,},[,],/n," " and = characters), but it would give
some idea when we start climbing in size...

Anyone else have any other ideas?

DanL

-- 
******************* ***************** ************* ***********
******* ***** *** **
"Quis custodiet ipsos custodes?" (Who can watch the watchmen?) -- from
the Satires of Juvenal
"I do not fear computers, I fear the lack of them." -- Isaac Asimov (Author)
** *** ***** ******* *********** ************* *****************
*******************

From dan at linder.org  Sun Nov  1 20:14:08 2009
From: dan at linder.org (Dan Linder)
Date: Sun, 1 Nov 2009 23:14:08 -0500
Subject: [Omaha.pm] BioPerl on FLOSS Weekly
In-Reply-To: <4AEB2B96.70501@Gmail.com>
References: <3e2be50910300857o2d718f03o9ef901957ec9c084@mail.gmail.com> 
	<4AEB2B96.70501@Gmail.com>
Message-ID: <3e2be50911012014k64b467e0o178bf40a1b3a8869@mail.gmail.com>

Zippo, Zich, Nada...  Just a simple Perl hacker who hangs out on this
mailing list. :-)

Dan

On Fri, Oct 30, 2009 at 13:08, Todd Christopher Hamilton
<netarttodd at gmail.com> wrote:
> Dan,
>
> I've wanted to know. ?What kind of stuff (cool stuff) are you doing in the
> area of biotech that you use perl for?
>
> Dan Linder wrote:
>>
>> Next weeks FLOSS Weekly is interviewing some BioPerl members: Marc
>> Pelletier, Edward Seufert.
>>
>> Here's the FLOSS Weekly URL: http://twit.tv/FLOSS
>>
>> Dan
>>
> _______________________________________________
> Omaha-pm mailing list
> Omaha-pm at pm.org
> http://mail.pm.org/mailman/listinfo/omaha-pm
>



-- 
******************* ***************** ************* ***********
******* ***** *** **
"Quis custodiet ipsos custodes?" (Who can watch the watchmen?) -- from
the Satires of Juvenal
"I do not fear computers, I fear the lack of them." -- Isaac Asimov (Author)
** *** ***** ******* *********** ************* *****************
*******************

From netarttodd at gmail.com  Mon Nov  2 12:06:09 2009
From: netarttodd at gmail.com (Todd Christopher Hamilton)
Date: Mon, 02 Nov 2009 14:06:09 -0600
Subject: [Omaha.pm] BioPerl on FLOSS Weekly
In-Reply-To: <3e2be50911012014k64b467e0o178bf40a1b3a8869@mail.gmail.com>
References: <3e2be50910300857o2d718f03o9ef901957ec9c084@mail.gmail.com>
	<4AEB2B96.70501@Gmail.com>
	<3e2be50911012014k64b467e0o178bf40a1b3a8869@mail.gmail.com>
Message-ID: <4AEF3BB1.2050504@Gmail.com>

Ah well.  Jay pointed me to some stuff he is doing but I am not smart 
enough to understand so I've go that going for me. Thanks.

Dan Linder wrote:
> Zippo, Zich, Nada...  Just a simple Perl hacker who hangs out on this
> mailing list. :-)
> 
> Dan
> 
> On Fri, Oct 30, 2009 at 13:08, Todd Christopher Hamilton
> <netarttodd at gmail.com> wrote:
>> Dan,
>>
>> I've wanted to know.  What kind of stuff (cool stuff) are you doing in the
>> area of biotech that you use perl for?
>>
>> Dan Linder wrote:
>>> Next weeks FLOSS Weekly is interviewing some BioPerl members: Marc
>>> Pelletier, Edward Seufert.
>>>
>>> Here's the FLOSS Weekly URL: http://twit.tv/FLOSS
>>>
>>> Dan
>>>
>> _______________________________________________
>> Omaha-pm mailing list
>> Omaha-pm at pm.org
>> http://mail.pm.org/mailman/listinfo/omaha-pm
>>
> 
> 
> 

From netarttodd at gmail.com  Mon Nov  2 12:07:33 2009
From: netarttodd at gmail.com (Todd Christopher Hamilton)
Date: Mon, 02 Nov 2009 14:07:33 -0600
Subject: [Omaha.pm] POE
In-Reply-To: <3e2be50911012014k64b467e0o178bf40a1b3a8869@mail.gmail.com>
References: <3e2be50910300857o2d718f03o9ef901957ec9c084@mail.gmail.com>
	<4AEB2B96.70501@Gmail.com>
	<3e2be50911012014k64b467e0o178bf40a1b3a8869@mail.gmail.com>
Message-ID: <4AEF3C05.8080507@Gmail.com>

Is there anyone doing anything with POE?  Todd

From sterling at hanenkamp.com  Mon Nov  2 12:46:16 2009
From: sterling at hanenkamp.com (Sterling Hanenkamp)
Date: Mon, 2 Nov 2009 14:46:16 -0600
Subject: [Omaha.pm] POE
In-Reply-To: <4AEF3C05.8080507@Gmail.com>
References: <3e2be50910300857o2d718f03o9ef901957ec9c084@mail.gmail.com>
	<4AEB2B96.70501@Gmail.com>
	<3e2be50911012014k64b467e0o178bf40a1b3a8869@mail.gmail.com>
	<4AEF3C05.8080507@Gmail.com>
Message-ID: <c185b40e0911021246j7b497098o68a7631a48697630@mail.gmail.com>

Not recently, but in the past year or so, yes.

On Mon, Nov 2, 2009 at 2:07 PM, Todd Christopher Hamilton <
netarttodd at gmail.com> wrote:

> Is there anyone doing anything with POE?  Todd
> _______________________________________________
> Omaha-pm mailing list
> Omaha-pm at pm.org
> http://mail.pm.org/mailman/listinfo/omaha-pm
>



-- 
Andrew Sterling Hanenkamp
sterling at hanenkamp.com
785.370.4454
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.pm.org/pipermail/omaha-pm/attachments/20091102/fb0a6810/attachment.html>

From jay at jays.net  Mon Nov  2 14:49:48 2009
From: jay at jays.net (Jay Hannah)
Date: Mon, 2 Nov 2009 16:49:48 -0600
Subject: [Omaha.pm] POE
In-Reply-To: <4AEF3C05.8080507@Gmail.com>
References: <3e2be50910300857o2d718f03o9ef901957ec9c084@mail.gmail.com>
	<4AEB2B96.70501@Gmail.com>
	<3e2be50911012014k64b467e0o178bf40a1b3a8869@mail.gmail.com>
	<4AEF3C05.8080507@Gmail.com>
Message-ID: <F06E3F12-FA7D-4D97-860B-69E518909C59@jays.net>

On Nov 2, 2009, at 2:07 PM, Todd Christopher Hamilton wrote:
> Is there anyone doing anything with POE?  Todd

Ya, we have a few TCP/IP and child process management systems in  
production.

POE::Wheel::Run
POE::Filter::Reference
POE::Component::Server::TCP

Huh. Looks like the MooseX::Workers I co-maint fell out of production.  
That's written on top of Moose and POE.

j


From jay at jays.net  Mon Nov  2 14:57:46 2009
From: jay at jays.net (Jay Hannah)
Date: Mon, 2 Nov 2009 16:57:46 -0600
Subject: [Omaha.pm] BioPerl on FLOSS Weekly
In-Reply-To: <4AEF3BB1.2050504@Gmail.com>
References: <3e2be50910300857o2d718f03o9ef901957ec9c084@mail.gmail.com>
	<4AEB2B96.70501@Gmail.com>
	<3e2be50911012014k64b467e0o178bf40a1b3a8869@mail.gmail.com>
	<4AEF3BB1.2050504@Gmail.com>
Message-ID: <216578C0-AB11-411B-B8C6-CA8CDBF2C5F9@jays.net>

On Nov 2, 2009, at 2:06 PM, Todd Christopher Hamilton wrote:
> Ah well.  Jay pointed me to some stuff he is doing but I am not  
> smart enough to understand so I've go that going for me.

If I can do BioPerl, anybody can. There's just a lot of biology /  
chemistry buzzwordiness thrown around. After that it's just a bunch of  
scalars, arrays, and hashes.  :)

j
 >CR936259 Natronomonas pharaonis DSM 2160 plasmid PL23 complete genome.
GCGTGACTGAAGACTTAGAGTTTGCGGTCGAGACGGACTGAAAACCCAGAACGGGATTGA
AACATTACGGCGAATGGACGCTCGATATGACGTTTGACGATGTCGAGACGGACTGAAAAC
CCAGAACGGGATTGAAACGTTGCGGTCGACGATTCAGGCGACCAACTCGAACGTCGA...


From TELarson at west.com  Wed Nov  4 13:31:53 2009
From: TELarson at west.com (Larson, Timothy E.)
Date: Wed, 4 Nov 2009 15:31:53 -0600
Subject: [Omaha.pm] Wow. \d is a lot  :)
In-Reply-To: <AD29AA3C-3FE1-40E8-B93B-D74A9F3DE9C3@jays.net>
References: <AD29AA3C-3FE1-40E8-B93B-D74A9F3DE9C3@jays.net>
Message-ID: <226316B3E1F749498E28ACA66321D5BA4A7A1ACA@oma00cexmbx03.corp.westworlds.com>

> Who knew there were so many digits?  :)
> 
> 16:19 < chansen> gshank: be explicit, use [0-9] or use \d if you mean
> any unicode digit
> 16:20 < chansen> gshank: what \d means if SvURT8 is true:
> 
> http://unicode.org/cldr/utility/list-unicodeset.jsp?a=%5B%3Adigit%3A%5D

What?  Doesn't include roman numerals?  Shoddy work, I say!


Tim

From jay at jays.net  Wed Nov  4 19:21:57 2009
From: jay at jays.net (Jay Hannah)
Date: Wed, 4 Nov 2009 21:21:57 -0600
Subject: [Omaha.pm] Future Perl snuck up on me
Message-ID: <015FAADA-4201-4293-BD2A-6914817A81F5@jays.net>

http://headrattle.blogspot.com/

j



From sterling at hanenkamp.com  Wed Nov  4 19:36:57 2009
From: sterling at hanenkamp.com (Sterling Hanenkamp)
Date: Wed, 4 Nov 2009 21:36:57 -0600
Subject: [Omaha.pm] Mapping Perl structures to a SQL table...
In-Reply-To: <3e2be50910310726p7a7b8390xba09741e23af35e5@mail.gmail.com>
References: <3e2be50910301131h5803fe21j5843873d37f9bd27@mail.gmail.com>
	<c185b40e0910301354t13b97ba2i4f04cc9d1a2af8fa@mail.gmail.com>
	<3e2be50910310726p7a7b8390xba09741e23af35e5@mail.gmail.com>
Message-ID: <c185b40e0911041936k309eb460v5c97ef4f5908ed06@mail.gmail.com>

On Sat, Oct 31, 2009 at 8:26 AM, Dan Linder <dan at linder.org> wrote:

> 2009/10/30 Sterling Hanenkamp <sterling at hanenkamp.com>:
> > If your data is all hashes, perhaps what you ought to look into is
> KiokuDB,
> > since it stores hashes very efficiently. If you can turn your hashes into
> > Moose classes while you're at it, all the better.
>
> The others on my team that work with this (albeit on a lesser level)
> are even wary of non-core Perl Modules or moving to a SQL DB at all.
> I'm taking baby-steps here hoping to help lead them into the "big
> kids" pool via the wading pool end.
>
> But I will look into KiokuDB -- it looks like an interesting module.
>

Well, if you really want to be cool, you'll convert your code to work in the
cloud via CouchDB or Amazon SimpleDB. RDBMS is soooo 1975. :-p All the cool
kids are looking to switch to some kind of cloud-stored object database.
(I'm not one of the cool kids, btw, since I use DBIx::Class for most of my
work at this point.)

KiokuDB is just interface library, like DBI. You can use memory
(KiokuDB::Backend::Hash), BerkeleyDB (K::B::BDB), a DBI connection
(K::B::DBI), Couch DB (K::B::CouchDB)or even just store one file per object
(K::B::File). In fact, if you wrote a Data::Dumper of
KiokuDB::Backend::Serialize, you could probably keep things very close to
what you have on the disk. :) It isn't a core module, though, and depends on
quite a few non-core modules, so that I can't help you with.

Stick with DBI if they want something conservative. DBI and RDBMS are about
as vanilla standard as it gets outside of Perl core. If you can get them to
go for it, DBIx::Class is a very nice way of staying away from writing tons
of SQL and making your code tie directly into a particular DB (which is an
awful place to be when you find out your RDBMS limitations don't fit your
app well, but now can't easily switch to something else).

Cheers.


>
> Dan
>
> --
> ******************* ***************** ************* ***********
> ******* ***** *** **
> "Quis custodiet ipsos custodes?" (Who can watch the watchmen?) -- from
> the Satires of Juvenal
> "I do not fear computers, I fear the lack of them." -- Isaac Asimov
> (Author)
> ** *** ***** ******* *********** ************* *****************
> *******************
> _______________________________________________
> Omaha-pm mailing list
> Omaha-pm at pm.org
> http://mail.pm.org/mailman/listinfo/omaha-pm
>



-- 
Andrew Sterling Hanenkamp
sterling at hanenkamp.com
785.370.4454
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.pm.org/pipermail/omaha-pm/attachments/20091104/9c01d9dc/attachment.html>

From netarttodd at gmail.com  Thu Nov  5 05:38:13 2009
From: netarttodd at gmail.com (Todd Christopher Hamilton)
Date: Thu, 05 Nov 2009 07:38:13 -0600
Subject: [Omaha.pm] Mapping Perl structures to a SQL table...
In-Reply-To: <c185b40e0911041936k309eb460v5c97ef4f5908ed06@mail.gmail.com>
References: <3e2be50910301131h5803fe21j5843873d37f9bd27@mail.gmail.com>	<c185b40e0910301354t13b97ba2i4f04cc9d1a2af8fa@mail.gmail.com>	<3e2be50910310726p7a7b8390xba09741e23af35e5@mail.gmail.com>
	<c185b40e0911041936k309eb460v5c97ef4f5908ed06@mail.gmail.com>
Message-ID: <4AF2D545.6010903@Gmail.com>

Not done reading but you had me a "you really want to be cool"

Sterling Hanenkamp wrote:
> On Sat, Oct 31, 2009 at 8:26 AM, Dan Linder <dan at linder.org 
> <mailto:dan at linder.org>> wrote:
> 
>     2009/10/30 Sterling Hanenkamp <sterling at hanenkamp.com
>     <mailto:sterling at hanenkamp.com>>:
>      > If your data is all hashes, perhaps what you ought to look into
>     is KiokuDB,
>      > since it stores hashes very efficiently. If you can turn your
>     hashes into
>      > Moose classes while you're at it, all the better.
> 
>     The others on my team that work with this (albeit on a lesser level)
>     are even wary of non-core Perl Modules or moving to a SQL DB at all.
>     I'm taking baby-steps here hoping to help lead them into the "big
>     kids" pool via the wading pool end.
> 
>     But I will look into KiokuDB -- it looks like an interesting module.
> 
> 
> Well, if you really want to be cool, you'll convert your code to work in 
> the cloud via CouchDB or Amazon SimpleDB. RDBMS is soooo 1975. :-p All 
> the cool kids are looking to switch to some kind of cloud-stored object 
> database. (I'm not one of the cool kids, btw, since I use DBIx::Class 
> for most of my work at this point.)
> 
> KiokuDB is just interface library, like DBI. You can use memory 
> (KiokuDB::Backend::Hash), BerkeleyDB (K::B::BDB), a DBI connection 
> (K::B::DBI), Couch DB (K::B::CouchDB)or even just store one file per 
> object (K::B::File). In fact, if you wrote a Data::Dumper of 
> KiokuDB::Backend::Serialize, you could probably keep things very close 
> to what you have on the disk. :) It isn't a core module, though, and 
> depends on quite a few non-core modules, so that I can't help you with.
> 
> Stick with DBI if they want something conservative. DBI and RDBMS are 
> about as vanilla standard as it gets outside of Perl core. If you can 
> get them to go for it, DBIx::Class is a very nice way of staying away 
> from writing tons of SQL and making your code tie directly into a 
> particular DB (which is an awful place to be when you find out your 
> RDBMS limitations don't fit your app well, but now can't easily switch 
> to something else).
> 
> Cheers.
>  
> 
> 
>     Dan
> 
>     --
>     ******************* ***************** ************* ***********
>     ******* ***** *** **
>     "Quis custodiet ipsos custodes?" (Who can watch the watchmen?) -- from
>     the Satires of Juvenal
>     "I do not fear computers, I fear the lack of them." -- Isaac Asimov
>     (Author)
>     ** *** ***** ******* *********** ************* *****************
>     *******************
>     _______________________________________________
>     Omaha-pm mailing list
>     Omaha-pm at pm.org <mailto:Omaha-pm at pm.org>
>     http://mail.pm.org/mailman/listinfo/omaha-pm
> 
> 
> 
> 
> -- 
> Andrew Sterling Hanenkamp
> sterling at hanenkamp.com <mailto:sterling at hanenkamp.com>
> 785.370.4454
> 
> 
> ------------------------------------------------------------------------
> 
> _______________________________________________
> Omaha-pm mailing list
> Omaha-pm at pm.org
> http://mail.pm.org/mailman/listinfo/omaha-pm

From jay at jays.net  Tue Nov 10 15:49:00 2009
From: jay at jays.net (Jay Hannah)
Date: Tue, 10 Nov 2009 17:49:00 -0600
Subject: [Omaha.pm] Meeting in 70 minutes!
In-Reply-To: <1FA801C6-A108-45AA-8DE8-F90D751F04AB@jays.net>
References: <1FA801C6-A108-45AA-8DE8-F90D751F04AB@jays.net>
Message-ID: <6585D0B0-3AF5-4EE5-BF10-F75E26CFE3FE@jays.net>

Oops. I forgot to also send to Perl Mongers 18 hours ago... Come on  
down!

    http://jays.net/wiki/Odlug

:)

j



> From: Jay Hannah <jay at jays.net>
> Date: November 10, 2009 12:27:30 AM CST
> To: odynug at googlegroups.com
> Subject: Meeting in 18.5 hours!
>
> Don't forget!  :)
>
> http://jays.net/wiki/Odlug
>
> * Scott Hickey presents Grails
>
> I'll bring pizza since it's now been 2 months since I've had any.  :)
>
> j
>
>


From choman at gmail.com  Tue Nov 10 16:08:17 2009
From: choman at gmail.com (Chad Homan)
Date: Tue, 10 Nov 2009 18:08:17 -0600
Subject: [Omaha.pm] Meeting in 70 minutes!
In-Reply-To: <6585D0B0-3AF5-4EE5-BF10-F75E26CFE3FE@jays.net>
References: <1FA801C6-A108-45AA-8DE8-F90D751F04AB@jays.net>
	<6585D0B0-3AF5-4EE5-BF10-F75E26CFE3FE@jays.net>
Message-ID: <d74b4e610911101608sccd49dajbb5b16b2bf68037f@mail.gmail.com>

I'm unable to make it, maybe next month


On Nov 10, 2009 5:49 PM, "Jay Hannah" <jay at jays.net> wrote:

Oops. I forgot to also send to Perl Mongers 18 hours ago... Come on down!

  http://jays.net/wiki/Odlug

:)

j



 From: Jay Hannah <jay at jays.net>
> Date: November 10, 2009 12:27:30 AM CST
> To: odynug at googlegroups.com
> Subject: Meeting in 18.5 hours!
>
> Don't forget!  :)
>
> http://jays.net/wiki/Odlug
>
> * Scott Hickey presents Grails
>
> I'll bring pizza since it's now been 2 months since I've had any.  :)
>
> j
>
>
>
_______________________________________________
Omaha-pm mailing list
Omaha-pm at pm.org
http://mail.pm.org/mailman/listinfo/omaha-pm
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.pm.org/pipermail/omaha-pm/attachments/20091110/4c0ff30f/attachment.html>

From jay at jays.net  Tue Nov 10 21:12:18 2009
From: jay at jays.net (Jay Hannah)
Date: Tue, 10 Nov 2009 23:12:18 -0600
Subject: [Omaha.pm] Our next 2 meetings
Message-ID: <438A5919-4E72-45F5-B8D5-9177EE7A0A8E@jays.net>

Trying to get ahead of the curve ...

Unless volunteers step forward to present, or people request topics  
(anyone?), it looks like these will be our next two meetings:

    http://jays.net/wiki/Odlug

Tuesday, December 8, 2009:
? Jay presents the Catalyst web development framework.
? Willing to do a 5 minute presentation on what you've been working  
on? Add yourself here!

Tuesday, January 12, 2010:
? PLT-Scheme mini hackathon (spearheaded by Scott Hickey)
? Willing to do a 5 minute presentation on what you've been working  
on? Add yourself here!

    http://jays.net/wiki/Odlug

(I also still need to catch up with Juan's Pet Paradise challenge  
entry. -grin-)

See you there!

j


From jay at jays.net  Wed Nov 11 05:19:52 2009
From: jay at jays.net (Jay Hannah)
Date: Wed, 11 Nov 2009 07:19:52 -0600
Subject: [Omaha.pm] Omaha's first-ever Catalyst Wed Dev Workshop!
Message-ID: <953CDFC6-A3AA-43CB-8F7D-8EEA93E71740@jays.net>

I want to try a new format for next month's meeting:

    http://jays.net/wiki/Catalyst_Workshop

Register yourself!  :)

j

From jay at jays.net  Mon Nov 23 16:41:05 2009
From: jay at jays.net (Jay Hannah)
Date: Mon, 23 Nov 2009 18:41:05 -0600
Subject: [Omaha.pm] Catalyst Workshop: 24 slots remaining
In-Reply-To: <6cb6eebc0911231419i7c686d7fy602d950219b58b00@mail.gmail.com>
References: <6cb6eebc0911192002m520587c4v32f6d263170f6561@mail.gmail.com>
	<8FDEDF70-8748-4522-887B-50A0BCEEDBC9@jays.net>
	<6cb6eebc0911231419i7c686d7fy602d950219b58b00@mail.gmail.com>
Message-ID: <42B1210D-3C5A-473A-9838-075F507EB3BA@jays.net>

Here's the list of people who have registered:

   http://jays.net/wiki/Catalyst_Workshop:_The_Excercise

First come, first serve.


On Nov 23, 2009, at 4:19 PM, Robert Fulkerson wrote:
> Glad to hear I'm on the roster.  Yay.  A rare night out and about that doesn't involve my children or my wife.  Whee.

PKI 276 is a "night out"?  You're a sick, sick man.   :)

> Anywho, any updated count on approximate number of available seats?  I can advertise in my 2850 class tomorrow, but will want to say "but there are only 6.5 seats left, so act fast!" if necessary.  ;)

Bring it on!

"Act fast! 24 slots remaining!"

Free food, drink provided 

   Sara Bachman, TEKsystems
   http://www.teksystems.com/Locations/United-States/Nebraska/Omaha.aspx

:)

j


From krisguy at krisguy.com  Mon Nov 23 17:05:32 2009
From: krisguy at krisguy.com (Kris Gainsforth)
Date: Mon, 23 Nov 2009 19:05:32 -0600
Subject: [Omaha.pm] Catalyst Workshop: 24 slots remaining
In-Reply-To: <42B1210D-3C5A-473A-9838-075F507EB3BA@jays.net>
References: <6cb6eebc0911192002m520587c4v32f6d263170f6561@mail.gmail.com>
	<8FDEDF70-8748-4522-887B-50A0BCEEDBC9@jays.net>
	<6cb6eebc0911231419i7c686d7fy602d950219b58b00@mail.gmail.com>
	<42B1210D-3C5A-473A-9838-075F507EB3BA@jays.net>
Message-ID: <88e8bc070911231705h21fda4a0l48354f777daf767a@mail.gmail.com>

Is this exercise going to be posted after the fact?  I can't make the
meeting, but I'd love to work the exercise.

Kris Gainsforth

On Mon, Nov 23, 2009 at 6:41 PM, Jay Hannah <jay at jays.net> wrote:

> Here's the list of people who have registered:
>
>   http://jays.net/wiki/Catalyst_Workshop:_The_Excercise
>
> First come, first serve.
>
>
> On Nov 23, 2009, at 4:19 PM, Robert Fulkerson wrote:
> > Glad to hear I'm on the roster.  Yay.  A rare night out and about that
> doesn't involve my children or my wife.  Whee.
>
> PKI 276 is a "night out"?  You're a sick, sick man.   :)
>
> > Anywho, any updated count on approximate number of available seats?  I
> can advertise in my 2850 class tomorrow, but will want to say "but there are
> only 6.5 seats left, so act fast!" if necessary.  ;)
>
> Bring it on!
>
> "Act fast! 24 slots remaining!"
>
> Free food, drink provided
>
>   Sara Bachman, TEKsystems
>   http://www.teksystems.com/Locations/United-States/Nebraska/Omaha.aspx
>
> :)
>
> j
>
> _______________________________________________
> Omaha-pm mailing list
> Omaha-pm at pm.org
> http://mail.pm.org/mailman/listinfo/omaha-pm
>



-- 
================
Kris Gainsforth
krisguy at krisguy.com
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.pm.org/pipermail/omaha-pm/attachments/20091123/10fa286f/attachment.html>

From jay at jays.net  Mon Nov 23 18:23:24 2009
From: jay at jays.net (Jay Hannah)
Date: Mon, 23 Nov 2009 20:23:24 -0600
Subject: [Omaha.pm] Catalyst Workshop: 24 slots remaining
In-Reply-To: <88e8bc070911231705h21fda4a0l48354f777daf767a@mail.gmail.com>
References: <6cb6eebc0911192002m520587c4v32f6d263170f6561@mail.gmail.com>
	<8FDEDF70-8748-4522-887B-50A0BCEEDBC9@jays.net>
	<6cb6eebc0911231419i7c686d7fy602d950219b58b00@mail.gmail.com>
	<42B1210D-3C5A-473A-9838-075F507EB3BA@jays.net>
	<88e8bc070911231705h21fda4a0l48354f777daf767a@mail.gmail.com>
Message-ID: <E8579244-7DCC-4C76-8D0A-6203646CA6A5@jays.net>

On Nov 23, 2009, at 7:05 PM, Kris Gainsforth wrote:
> Is this exercise going to be posted after the fact?  I can't make the meeting, but I'd love to work the exercise.

All the steps will be on the wiki as soon as I come up with them, sometime before the Workshop. I've created dozens of little Cat apps (and two that are now enormous) over the last 2 years, so I just have to pick a theme for the exercise and roll with it. The wiki will be there for reference for everyone during the Workshop. We'll walk through the steps together. Rebels can work at their own pace. The exercise will remain online for... years, probably.

http://jays.net/wiki/Catalyst_Workshop:_The_Exercise

Cheers,

j


From krisguy at krisguy.com  Mon Nov 23 18:25:46 2009
From: krisguy at krisguy.com (Kris Gainsforth)
Date: Mon, 23 Nov 2009 20:25:46 -0600
Subject: [Omaha.pm] Catalyst Workshop: 24 slots remaining
In-Reply-To: <E8579244-7DCC-4C76-8D0A-6203646CA6A5@jays.net>
References: <6cb6eebc0911192002m520587c4v32f6d263170f6561@mail.gmail.com> 
	<8FDEDF70-8748-4522-887B-50A0BCEEDBC9@jays.net>
	<6cb6eebc0911231419i7c686d7fy602d950219b58b00@mail.gmail.com> 
	<42B1210D-3C5A-473A-9838-075F507EB3BA@jays.net>
	<88e8bc070911231705h21fda4a0l48354f777daf767a@mail.gmail.com> 
	<E8579244-7DCC-4C76-8D0A-6203646CA6A5@jays.net>
Message-ID: <-6792322406531587128@unknownmsgid>

Jay, I am working the lolCatalyst app from the Apress book, but it
doesn't hurt to have another look.

-------------
Sent from my iPhone
Kris Gainsforth

On Nov 23, 2009, at 8:23 PM, Jay Hannah <jay at jays.net> wrote:

> On Nov 23, 2009, at 7:05 PM, Kris Gainsforth wrote:
>> Is this exercise going to be posted after the fact?  I can't make
>> the meeting, but I'd love to work the exercise.
>
> All the steps will be on the wiki as soon as I come up with them,
> sometime before the Workshop. I've created dozens of little Cat apps
> (and two that are now enormous) over the last 2 years, so I just
> have to pick a theme for the exercise and roll with it. The wiki
> will be there for reference for everyone during the Workshop. We'll
> walk through the steps together. Rebels can work at their own pace.
> The exercise will remain online for... years, probably.
>
> http://jays.net/wiki/Catalyst_Workshop:_The_Exercise
>
> Cheers,
>
> j
>
> _______________________________________________
> Omaha-pm mailing list
> Omaha-pm at pm.org
> http://mail.pm.org/mailman/listinfo/omaha-pm

From jay at jays.net  Mon Nov 23 19:17:57 2009
From: jay at jays.net (Jay Hannah)
Date: Mon, 23 Nov 2009 21:17:57 -0600
Subject: [Omaha.pm] Catalyst Workshop: 24 slots remaining
In-Reply-To: <-6792322406531587128@unknownmsgid>
References: <6cb6eebc0911192002m520587c4v32f6d263170f6561@mail.gmail.com>
	<8FDEDF70-8748-4522-887B-50A0BCEEDBC9@jays.net>
	<6cb6eebc0911231419i7c686d7fy602d950219b58b00@mail.gmail.com>
	<42B1210D-3C5A-473A-9838-075F507EB3BA@jays.net>
	<88e8bc070911231705h21fda4a0l48354f777daf767a@mail.gmail.com>
	<E8579244-7DCC-4C76-8D0A-6203646CA6A5@jays.net>
	<-6792322406531587128@unknownmsgid>
Message-ID: <E10AE94C-9156-48DF-B21C-F6AC99A64E9D@jays.net>

On Nov 23, 2009, at 8:25 PM, Kris Gainsforth wrote:
> Jay, I am working the lolCatalyst app from the Apress book, but it
> doesn't hurt to have another look.

I just received my copy of that book (http://www.catalystframework.org/) the other day. I haven't had time to look through it yet to see how many of my current techniques are considered No Longer Cool by the authors.   :)

I'll be bringing both books (Packt and Apress) it to the Workshop. 

j


From choman at gmail.com  Tue Nov 24 14:48:02 2009
From: choman at gmail.com (Chad Homan)
Date: Tue, 24 Nov 2009 16:48:02 -0600
Subject: [Omaha.pm] Catalyst Workshop: 24 slots remaining
In-Reply-To: <E10AE94C-9156-48DF-B21C-F6AC99A64E9D@jays.net>
References: <6cb6eebc0911192002m520587c4v32f6d263170f6561@mail.gmail.com>
	<8FDEDF70-8748-4522-887B-50A0BCEEDBC9@jays.net>
	<6cb6eebc0911231419i7c686d7fy602d950219b58b00@mail.gmail.com>
	<42B1210D-3C5A-473A-9838-075F507EB3BA@jays.net>
	<88e8bc070911231705h21fda4a0l48354f777daf767a@mail.gmail.com>
	<E8579244-7DCC-4C76-8D0A-6203646CA6A5@jays.net>
	<-6792322406531587128@unknownmsgid>
	<E10AE94C-9156-48DF-B21C-F6AC99A64E9D@jays.net>
Message-ID: <d74b4e610911241448y3b61dad9ud7c33a9cd9c7d11f@mail.gmail.com>

I am so bummed, unable to make it
Looking forward to online lessons

On Nov 23, 2009 9:18 PM, "Jay Hannah" <jay at jays.net> wrote:

On Nov 23, 2009, at 8:25 PM, Kris Gainsforth wrote: > Jay, I am working the
lolCatalyst app from the...
I just received my copy of that book (http://www.catalystframework.org/) the
other day. I haven't had time to look through it yet to see how many of my
current techniques are considered No Longer Cool by the authors.   :)

I'll be bringing both books (Packt and Apress) it to the Workshop.

j _______________________________________________ Omaha-pm mailing list
Omaha-pm at pm.org http://mai...
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.pm.org/pipermail/omaha-pm/attachments/20091124/a0b9aae3/attachment.html>

From jay at jays.net  Fri Nov 27 19:30:52 2009
From: jay at jays.net (Jay Hannah)
Date: Fri, 27 Nov 2009 21:30:52 -0600
Subject: [Omaha.pm] Fwd: [pm_groups] ISO location for perl/data center
References: <876393t1mt.fsf@quad.sysarch.com>
Message-ID: <CD397F97-E424-47C9-A916-19582C0E937F@jays.net>

An HTML attachment was scrubbed...
URL: <http://mail.pm.org/pipermail/omaha-pm/attachments/20091127/fb26a71f/attachment.html>